Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RENBP cdna clone

RENBP cDNA Clone

Gene Names
RENBP; RBP; RNBP
Synonyms
RENBP; RENBP cDNA Clone; RENBP cdna clone
Ordering
For Research Use Only!
Sequence
atggagaaagagcgagagactctgcaggcctggaaggagcgcgtggggcaggagctggaccgcgtggtggctttctggatggagcactcccacgaccaggagcacgggggcttcttcacgtgccttggccgcgaggggcgggtgtatgatgacctcaagtatgtgtggctgcaggggaggcaggtatggatgtattgtcgcctgtaccgcactttcgagcgcttccgccatgctcagcttctggacgcagcaaaagcaggtggtgagttcttgctgcggtatgcccgggtggcacctcctggcaagaagtgtgcctttgtgctgactcgggacggccgcccggtcaaggtgcagcgaaccatcttcagtgagtgtttctacaccatggccatgaacgagctgtggagagccacaggggaagtgcggtaccagacggaagcggtggagatgatggatcagatcgtccactgggtgcaggaggacgcgtcgggactgggccggccccagctccagggggccccggctgcggagcccatggcggtgcccatgatgctactgaacctggtggagcagctcggggaggcagatgaggagctggcgggcaaatacgcagagctgggggactggtgcgcccggaggattctgcagcacgtgcagagggatggacaagctgtgccggagaatgtgtcagagggtggcaaggaacttcctggctgcctggggagacagcagaacccaggccacacgctggaagccggctggtttctgctccgtcattgcattcggaaaggcgaccccgaacttcgagcccacgtgattgacaagttcctattgttgcccttccactccggatgggaccctgaccacggaggcctcttttacttccaggatgctgataacttctgccccacccagctggagtgggccatgaagctctggtggccacacagtgaagccatgattgccttcctcatgggttacagtgacagtggggaccctgtgctgctgcgcctcttctaccaagtggctgagtacaccttccgccagtttcgcgatcccgagtacggggaatggtttggctacctgagccgagagggcaaggtggccctctccatcaagggaggtcctttcaaaggctgcttccacgtgccgcggtgcctagccatgtgcgaggagatgctgggcgccctgctgagccgccccgcccccgccccctcccccgcccccacccccgcctgccgaggcgcggaataa
Sequence Length
1254
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,270 Da
NCBI Official Full Name
Homo sapiens renin binding protein, mRNA
NCBI Official Synonym Full Names
renin binding protein
NCBI Official Symbol
RENBP
NCBI Official Synonym Symbols
RBP; RNBP
NCBI Protein Information
N-acylglucosamine 2-epimerase
UniProt Protein Name
N-acylglucosamine 2-epimerase
UniProt Gene Name
RENBP
UniProt Synonym Gene Names
AGE; RnBP
UniProt Entry Name
RENBP_HUMAN

NCBI Description

The gene product inhibits renin activity by forming a dimer with renin, a complex known as high molecular weight renin. The encoded protein contains a leucine zipper domain, which is essential for its dimerization with renin. The gene product can catalyze the interconversion of N-acetylglucosamine to N-acetylmannosamine, indicating that it is a GlcNAc 2-epimerase. Transcript variants utilizing alternative promoters have been described in the literature. [provided by RefSeq, Jul 2008]

Uniprot Description

RENBP: Catalyzes the interconversion of N-acetylglucosamine to N-acetylmannosamine. Binds to renin forming a protein complex called high molecular weight (HMW) renin and inhibits renin activity. Belongs to the N-acylglucosamine 2-epimerase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Isomerase; Carbohydrate Metabolism - amino sugar and nucleotide sugar; Inhibitor; EC 5.1.3.8

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cytosol

Molecular Function: endopeptidase inhibitor activity; N-acylglucosamine 2-epimerase activity

Biological Process: N-acetylglucosamine metabolic process; N-acetylneuraminate catabolic process; regulation of blood pressure; UDP-N-acetylglucosamine biosynthetic process

Research Articles on RENBP

Similar Products

Product Notes

The RENBP renbp (Catalog #AAA1269229) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaaag agcgagagac tctgcaggcc tggaaggagc gcgtggggca ggagctggac cgcgtggtgg ctttctggat ggagcactcc cacgaccagg agcacggggg cttcttcacg tgccttggcc gcgaggggcg ggtgtatgat gacctcaagt atgtgtggct gcaggggagg caggtatgga tgtattgtcg cctgtaccgc actttcgagc gcttccgcca tgctcagctt ctggacgcag caaaagcagg tggtgagttc ttgctgcggt atgcccgggt ggcacctcct ggcaagaagt gtgcctttgt gctgactcgg gacggccgcc cggtcaaggt gcagcgaacc atcttcagtg agtgtttcta caccatggcc atgaacgagc tgtggagagc cacaggggaa gtgcggtacc agacggaagc ggtggagatg atggatcaga tcgtccactg ggtgcaggag gacgcgtcgg gactgggccg gccccagctc cagggggccc cggctgcgga gcccatggcg gtgcccatga tgctactgaa cctggtggag cagctcgggg aggcagatga ggagctggcg ggcaaatacg cagagctggg ggactggtgc gcccggagga ttctgcagca cgtgcagagg gatggacaag ctgtgccgga gaatgtgtca gagggtggca aggaacttcc tggctgcctg gggagacagc agaacccagg ccacacgctg gaagccggct ggtttctgct ccgtcattgc attcggaaag gcgaccccga acttcgagcc cacgtgattg acaagttcct attgttgccc ttccactccg gatgggaccc tgaccacgga ggcctctttt acttccagga tgctgataac ttctgcccca cccagctgga gtgggccatg aagctctggt ggccacacag tgaagccatg attgccttcc tcatgggtta cagtgacagt ggggaccctg tgctgctgcg cctcttctac caagtggctg agtacacctt ccgccagttt cgcgatcccg agtacgggga atggtttggc tacctgagcc gagagggcaa ggtggccctc tccatcaagg gaggtccttt caaaggctgc ttccacgtgc cgcggtgcct agccatgtgc gaggagatgc tgggcgccct gctgagccgc cccgcccccg ccccctcccc cgcccccacc cccgcctgcc gaggcgcgga ataa. It is sometimes possible for the material contained within the vial of "RENBP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.