Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

REG1B cdna clone

REG1B cDNA Clone

Gene Names
REG1B; REGH; REGL; PSPS2; REGI-BETA
Synonyms
REG1B; REG1B cDNA Clone; REG1B cdna clone
Ordering
For Research Use Only!
Sequence
atggctcagaccaactcgttcttcatgctgatctcctccctgatgttcctgtctctgagccaaggccaggagtcccagacagagctgcctaatccccgaatcagctgcccagaaggcaccaatgcctatcgctcctactgctactactttaatgaagaccctgagacctgggttgatgcagatctctattgccagaacatgaattcaggcaacctggtgtctgtgctcacccaggcggagggtgccttcgtggcctcactgattaaggagagtagcactgatgacagcaatgtctggattggcctccatgacccaaaaaagaaccgccgctggcactggagtagtgggtccctggtctcctacaagtcctgggacactggatccccgagcagtgctaatgctggctactgtgcaagcctgacttcatgctcaggattcaagaaatggaaggatgaatcttgtgagaagaagttctcctttgtttgcaagttcaaaaactag
Sequence Length
501
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,665 Da
NCBI Official Full Name
Homo sapiens regenerating islet-derived 1 beta, mRNA
NCBI Official Synonym Full Names
regenerating family member 1 beta
NCBI Official Symbol
REG1B
NCBI Official Synonym Symbols
REGH; REGL; PSPS2; REGI-BETA
NCBI Protein Information
lithostathine-1-beta
UniProt Protein Name
Lithostathine-1-beta
Protein Family
UniProt Gene Name
REG1B
UniProt Synonym Gene Names
PSPS2; REGL; PSP-2; REG-1-beta
UniProt Entry Name
REG1B_HUMAN

NCBI Description

This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV based on the primary structures of the encoded proteins. This gene encodes a protein secreted by the exocrine pancreas that is highly similar to the REG1A protein. The related REG1A protein is associated with islet cell regeneration and diabetogenesis, and may be involved in pancreatic lithogenesis. Reg family members REG1A, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]

Uniprot Description

REG1B: Might act as an inhibitor of spontaneous calcium carbonate precipitation. May be associated with neuronal sprouting in brain, and with brain and pancreas regeneration.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 2p12

Biological Process: cell proliferation

Research Articles on REG1B

Similar Products

Product Notes

The REG1B reg1b (Catalog #AAA1266740) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcaga ccaactcgtt cttcatgctg atctcctccc tgatgttcct gtctctgagc caaggccagg agtcccagac agagctgcct aatccccgaa tcagctgccc agaaggcacc aatgcctatc gctcctactg ctactacttt aatgaagacc ctgagacctg ggttgatgca gatctctatt gccagaacat gaattcaggc aacctggtgt ctgtgctcac ccaggcggag ggtgccttcg tggcctcact gattaaggag agtagcactg atgacagcaa tgtctggatt ggcctccatg acccaaaaaa gaaccgccgc tggcactgga gtagtgggtc cctggtctcc tacaagtcct gggacactgg atccccgagc agtgctaatg ctggctactg tgcaagcctg acttcatgct caggattcaa gaaatggaag gatgaatctt gtgagaagaa gttctccttt gtttgcaagt tcaaaaacta g. It is sometimes possible for the material contained within the vial of "REG1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.