Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RECK cdna clone

RECK cDNA Clone

Gene Names
RECK; ST15
Synonyms
RECK; RECK cDNA Clone; RECK cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaccgtccgggcctctctgcgaggtgcgctgccccttctgctggccgtgacgggggtcgcggaggtggcagggggcctggctccgggcagtgcgggtgcattgtgttgtaatcattcaaaggataaccaaatgtgccgtgatgtatgtgaacagattttctcctcaaaaagtgaatcccgactaaaacatctgttgcagcgagccccagattattgcccagagacaatggttgaaatttggaattgtatgaattcatctttgccaggtgtgtttaagaagtctgatggctgggttggcttaggctgctgtgaactggctattgccttggagtgtcgacaggcatgcaagcaggcatcttcaaagaatgatatttccaaagtttgcagaaaagaatatgagaatgctcttttcagttgcattagcagaaatgaaatgggctcggtttgttgcagttatgcaggtcatcacacaaactgccgagaatactgtcaagccatttttcgaacagactcttctcctggtccatctcagataaaagcagtggaaaattattgcgcctctattagtccacaattaatacattgtgtgaacaattatactcaatcttatccaatgaggaacccaacggatatgtttgaattttttgccaatgagcaattattacttttgtaa
Sequence Length
678
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,457 Da
NCBI Official Full Name
Homo sapiens reversion-inducing-cysteine-rich protein with kazal motifs, mRNA
NCBI Official Synonym Full Names
reversion inducing cysteine rich protein with kazal motifs
NCBI Official Symbol
RECK
NCBI Official Synonym Symbols
ST15
NCBI Protein Information
reversion-inducing cysteine-rich protein with Kazal motifs
UniProt Protein Name
Reversion-inducing cysteine-rich protein with Kazal motifs
UniProt Gene Name
RECK
UniProt Synonym Gene Names
ST15; hRECK
UniProt Entry Name
RECK_HUMAN

NCBI Description

The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Uniprot Description

RECK: Negatively regulates matrix metalloproteinase-9 (MMP-9) by suppressing MMP-9 secretion and by direct inhibition of its enzymatic activity. RECK down-regulation by oncogenic signals may facilitate tumor invasion and metastasis. Appears to also regulate MMP-2 and MT1-MMP, which are involved in cancer progression. Interacts with MMP-9. Expressed in various tissues and untransformed cells. It is undetectable in tumor-derived cell lines and oncogenically transformed cells.

Protein type: Membrane protein, GPI anchor; Tumor suppressor

Chromosomal Location of Human Ortholog: 9p13.3

Cellular Component: membrane

Molecular Function: endopeptidase inhibitor activity; metalloendopeptidase inhibitor activity; protein binding

Biological Process: extracellular matrix organization and biogenesis; negative regulation of cell migration

Research Articles on RECK

Similar Products

Product Notes

The RECK reck (Catalog #AAA1271389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccg tccgggcctc tctgcgaggt gcgctgcccc ttctgctggc cgtgacgggg gtcgcggagg tggcaggggg cctggctccg ggcagtgcgg gtgcattgtg ttgtaatcat tcaaaggata accaaatgtg ccgtgatgta tgtgaacaga ttttctcctc aaaaagtgaa tcccgactaa aacatctgtt gcagcgagcc ccagattatt gcccagagac aatggttgaa atttggaatt gtatgaattc atctttgcca ggtgtgttta agaagtctga tggctgggtt ggcttaggct gctgtgaact ggctattgcc ttggagtgtc gacaggcatg caagcaggca tcttcaaaga atgatatttc caaagtttgc agaaaagaat atgagaatgc tcttttcagt tgcattagca gaaatgaaat gggctcggtt tgttgcagtt atgcaggtca tcacacaaac tgccgagaat actgtcaagc catttttcga acagactctt ctcctggtcc atctcagata aaagcagtgg aaaattattg cgcctctatt agtccacaat taatacattg tgtgaacaat tatactcaat cttatccaat gaggaaccca acggatatgt ttgaattttt tgccaatgag caattattac ttttgtaa. It is sometimes possible for the material contained within the vial of "RECK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.