Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RCOR3 cdna clone

RCOR3 cDNA Clone

Synonyms
RCOR3; RCOR3 cDNA Clone; RCOR3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccggcatgatggagaaagggcccgagttactggggaagaaccgatcggccaacggcagcgccaagagcccggcaggcggcggcggcagcggcgcctcgtccaccaacggcgggctgcactactcagagcccgagagcggctgcagcagcgacgacgagcacgatgttgggatgagagtcggagccgaataccaagctcggatccctgaatttgatccaggtgctacaaagtacacagataaagacaatggagggatgcttgtatggtctccatatcacagtatcccagatgccagattggatgaatacattgcaattgcaaaggaaaagcatggctacaatgtggaacaggcacttggcatgttgttctggcataaacataacattgagaagtcccttgctgatctccctaatttcactccctttccggatgagtggacagtggaagataaagtcctatttgaacaagcctttagttttcatggaaagagctttcacaggattcagcaaatgcttccagataagacaattgcaagccttgtaaaatattactattcttggaaaaaaactcgctctaggacaagtttgatggatcgccaggctcgtaaactagctaatagacataatcagggtgacagtgatgatgatgtagaagaaacacatccaatggatgggaatgatagtgattatgatcccaaaaaagaagccaaaaaagagggtaatactgaacaacctgtccaaactagcaagattggacttggaagaagagagtatcagagtttacaacatcgccatcattctcagcgttctaagtgccgtccacctaagggcatgtatttaacccaggaagatgtggtagcagtttcctgtagtcccaatgcagccaacaccatcctgaggcaactggacatggagttgatctctctaaaacgtcaggttcagaatgctaagcaagtaaacagtgcacttaaacagaaaatggaaggtggaattgaagaattcaaacctcctgagtcaaatcagaaaattaatgcccgttggaccacagaggagcagcttctagcagtgcaaggcacagaccccacaggctcctcggacactgggtccatcacctcctgccccatcatccactccaacaccaacagcccctattgccactctgaaccagcctccaccacttcttcgtccaacactgcctgctgccccggctcttcaccggcagcctcctccactccagcagcaggctcggttcatccagccccggccaactttaaatcagcctccaccacctcttattcgccctgctaa
Sequence Length
1311
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,377 Da
NCBI Official Full Name
Homo sapiens REST corepressor 3, mRNA
NCBI Official Synonym Full Names
REST corepressor 3
NCBI Official Symbol
RCOR3
NCBI Protein Information
REST corepressor 3
UniProt Protein Name
REST corepressor 3
Protein Family
UniProt Gene Name
RCOR3
UniProt Synonym Gene Names
KIAA1343
UniProt Entry Name
RCOR3_HUMAN

Uniprot Description

RCOR3: May act as a component of a corepressor complex that represses transcription (Potential). Belongs to the CoREST family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 1q32.2

Cellular Component: nucleus; transcription factor complex; transcriptional repressor complex

Molecular Function: protein binding; transcription corepressor activity; transcription factor activity; transcription factor binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter

Research Articles on RCOR3

Similar Products

Product Notes

The RCOR3 rcor3 (Catalog #AAA1272996) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccggca tgatggagaa agggcccgag ttactgggga agaaccgatc ggccaacggc agcgccaaga gcccggcagg cggcggcggc agcggcgcct cgtccaccaa cggcgggctg cactactcag agcccgagag cggctgcagc agcgacgacg agcacgatgt tgggatgaga gtcggagccg aataccaagc tcggatccct gaatttgatc caggtgctac aaagtacaca gataaagaca atggagggat gcttgtatgg tctccatatc acagtatccc agatgccaga ttggatgaat acattgcaat tgcaaaggaa aagcatggct acaatgtgga acaggcactt ggcatgttgt tctggcataa acataacatt gagaagtccc ttgctgatct ccctaatttc actccctttc cggatgagtg gacagtggaa gataaagtcc tatttgaaca agcctttagt tttcatggaa agagctttca caggattcag caaatgcttc cagataagac aattgcaagc cttgtaaaat attactattc ttggaaaaaa actcgctcta ggacaagttt gatggatcgc caggctcgta aactagctaa tagacataat cagggtgaca gtgatgatga tgtagaagaa acacatccaa tggatgggaa tgatagtgat tatgatccca aaaaagaagc caaaaaagag ggtaatactg aacaacctgt ccaaactagc aagattggac ttggaagaag agagtatcag agtttacaac atcgccatca ttctcagcgt tctaagtgcc gtccacctaa gggcatgtat ttaacccagg aagatgtggt agcagtttcc tgtagtccca atgcagccaa caccatcctg aggcaactgg acatggagtt gatctctcta aaacgtcagg ttcagaatgc taagcaagta aacagtgcac ttaaacagaa aatggaaggt ggaattgaag aattcaaacc tcctgagtca aatcagaaaa ttaatgcccg ttggaccaca gaggagcagc ttctagcagt gcaaggcaca gaccccacag gctcctcgga cactgggtcc atcacctcct gccccatcat ccactccaac accaacagcc cctattgcca ctctgaacca gcctccacca cttcttcgtc caacactgcc tgctgccccg gctcttcacc ggcagcctcc tccactccag cagcaggctc ggttcatcca gccccggcca actttaaatc agcctccacc acctcttatt cgccctgcta a. It is sometimes possible for the material contained within the vial of "RCOR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.