RBX1 cdna clone

RBX1 cDNA Clone

Cat. Num. AAA1271883

• Gene Names: RBX1; ROC1; RNF75; BA554C12.1
• Synonyms: RBX1; RBX1 cDNA Clone; RBX1 cdna clone

• Sequence: atggcggcagcgatggatgtggataccccgagcggcaccaacagcggcgcgggcaagaagcgctttgaagtgaaaaagtggaatgcagtagccctctgggcctgggatattgtggttgataactgtgccatctgcaggaaccacattatggatctttgcatagaatgtcaagctaaccaggcgtccgctacttcagaagagtgtactgtcgcatggggagtctgtaaccatgcttttcacttccactgcatctctcgctggctcaaaacacgacaggtgtgtccattggacaacagagagtgggaattccaaaagtatgggcactag
• Sequence Length: 327

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 34783098
• NCBI GeneID: 9978
• Molecular Weight: 12,274 Da
• NCBI Official Full Name: Homo sapiens ring-box 1, mRNA
• NCBI Official Synonym Full Names: ring-box 1
• NCBI Official Symbol: RBX1
• NCBI Official Synonym Symbols: ROC1; RNF75; BA554C12.1
• NCBI Protein Information: E3 ubiquitin-protein ligase RBX1
• UniProt Protein Name: E3 ubiquitin-protein ligase RBX1
• Protein Family: RING-box protein
• UniProt Gene Name: RBX1
• UniProt Synonym Gene Names: RNF75; ROC1; Rbx1
• UniProt Entry Name: RBX1_HUMAN

NCBI Description

This locus encodes a RING finger-like domain-containing protein. The encoded protein interacts with cullin proteins and likely plays a role in ubiquitination processes necessary for cell cycle progression. This protein may also affect protein turnover. Related pseudogenes exist on chromosomes 2 and 5.[provided by RefSeq, Sep 2010]

Uniprot Description

RBX1: E3 ubiquitin ligase component of multiple cullin-RING- based E3 ubiquitin-protein ligase complexes which mediate the ubiquitination and subsequent proteasomal degradation of target proteins, including proteins involved in cell cycle progression, signal transduction, transcription and transcription-coupled nucleotide excision repair. The functional specificity of the E3 ubiquitin-protein ligase complexes depends on the variable substrate recognition components. As a component of the CSA complex promotes the ubiquitination of ERCC6 resulting in proteasomal degradation. Through the RING-type zinc finger, seems to recruit the E2 ubiquitination enzyme, like CDC34, to the complex and brings it into close proximity to the substrate. Probably also stimulates CDC34 autoubiquitination. May be required for histone H3 and histone H4 ubiquitination in response to ultraviolet and for subsequent DNA repair. Promotes the neddylation of CUL1, CUL2, CUL4 and CUL4 via its interaction with UBE2M. Part of a SCF complex consisting of CUL1, RBX1, SKP1 and SKP2. Part of a SCF-like complex consisting of CUL7, RBX1, SKP1 and FBXW8. Part of CBC(VHL) complexes with elongin BC complex (TCEB1 and TCEB2), CUL2 or CUL5 and VHL. Part of the CSA complex (DCX(ERCC8) complex), a DCX E3 ubiquitin-protein ligase complex containing ERCC8, RBX1, DDB1 and CUL4A; the CSA complex interacts with RNA polymerase II; upon UV irradiation it interacts with the COP9 signalosome and preferentially with the hyperphosphorylated form of RNA polymerase II. Part of multisubunit E3 ubiquitin ligase complexes with elongin BC complex (TCEB1 and TCEB2), CUL2 and MED8; elongin BC complex (TCEB1 and TCEB2), CUL5 and MUF1. Part of multisubunit complexes with elongin BC complex (TCEB1 and TCEB2), elongin A/TCEB3 or SOCS1 or WSB1 and CUL5. Interacts directly with CUL1 and probably also with CUL2, CUL3, CUL4A, CUL4B, CUL5 and CUL7. Probably interacts with CDC34. Interacts with COPS6. Component of the DCX DET1-COP1 ubiquitin ligase complex at least composed of RBX1, DET1, DDB1, CUL4A and COP1. Part of an E3 ligase complex composed of RBX1, DDB1, DDB2 and CUL4A or CUL4B. Interacts with UBE2M. Part of a SCF complex consisting of CUL1, FBXO3, RBX1 and SKP1; this complex interacts with PML via FBXO3. Interacts with human adenovirus early E1A protein; this interaction inhibits RBX1-CUL1-dependent elongation reaction of ubiquitin chains by the SCF(FBW7) complex. Component of the SCF(Cyclin F) complex consisting of CUL1, RBX1, SKP1 and CCNF. Widely expressed. Belongs to the RING-box family.

Protein type: Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.-; Ligase

Chromosomal Location of Human Ortholog: 22q13.2

Cellular Component: Cul2-RING ubiquitin ligase complex; Cul5-RING ubiquitin ligase complex; cullin-RING ubiquitin ligase complex; cytosol; nucleoplasm; SCF ubiquitin ligase complex

Molecular Function: NEDD8 ligase activity; protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: DNA damage response, detection of DNA damage; MAPKKK cascade; nucleotide-excision repair, DNA damage recognition; nucleotide-excision repair, DNA duplex unwinding; nucleotide-excision repair, DNA incision; nucleotide-excision repair, DNA incision, 3'-to lesion; nucleotide-excision repair, DNA incision, 5'-to lesion; nucleotide-excision repair, preincision complex assembly; nucleotide-excision repair, preincision complex stabilization; proteasomal ubiquitin-dependent protein catabolic process; protein monoubiquitination; protein neddylation; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; SCF-dependent proteasomal ubiquitin-dependent protein catabolic process; transcription-coupled nucleotide-excision repair; Wnt receptor signaling pathway