Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBM22 cdna clone

RBM22 cDNA Clone

Gene Names
RBM22; Cwc2; ZC3H16; fSAP47
Synonyms
RBM22; RBM22 cDNA Clone; RBM22 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacctctctgggttccaacacctacaacaggcagaactgggaggatgcggacttccccattctgtgccagacatgtcttggagaaaacccatatatccgaatgaccaaagaaaagtatgggaaggaatgcaaaatctgtgccaggccattcacagtgtttcgctggtgccctggagtccgcatgcgtttcaagaagactgaagtgtgccaaacctgcagtaaattgaagaatgtctgtcagacctgcctcttagacctagagtatggcctgcccatccaggttcgtgacgcaggattgtcttttaaagatgacatgccaaagtcagatgtcaacaaagagtactatacacagaatatggagagagagatttctaactctgatggaacacggccagttggcatgctggggaaagccacatctaccagtgacatgctgctcaaactggcccggaccacaccctactacaaaaggaatcgaccccacatttgctccttctgggtgaaaggagagtgtaagagaggagaggaatgtccatacagacatgagaagcctacagatccagatgacccccttgctgatcagaatattaaagaccgttattacggaatcaatgatcctgtagctgacaagcttctaaagcgggcttcaacaatgcctcggctggacccaccagaggataaaactatcaccacactatatgttggtggtctaggtgataccattactgagacagatttaagaaatcatttctaccagttcggagagatccggacgatcactgttgtgcagagacagcagtgtgctttcatccagtttgccacacggcaggctgcagaagtggctgctgagaagtcctttaataagttgattgtaaatggccgcagactgaatgtgaaatggggaagatcccaggcagccagaggaaaagaaaaagagaaagatggaactacagactctgggatcaaactagaacctgttccaggattgccaggagctcttcctcctcctcctgcagcagaagaagaagcctctgccaactacttcaacttgcccccaagtggtcctccagctgtggtgaacattgctctgccaccgccccctggcattgctccacccccacccccaggttttgggccacacatgttccacccaatgggaccaccccctcctttcatgcgggctccaggaccaatccactatccttctcaggaccctcagaggatgggagctcatgctggaaaacacagcagcccctag
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,152 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 22, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 22
NCBI Official Symbol
RBM22
NCBI Official Synonym Symbols
Cwc2; ZC3H16; fSAP47
NCBI Protein Information
pre-mRNA-splicing factor RBM22
UniProt Protein Name
Pre-mRNA-splicing factor RBM22
Protein Family
UniProt Gene Name
RBM22
UniProt Synonym Gene Names
ZC3H16
UniProt Entry Name
RBM22_HUMAN

NCBI Description

This gene encodes an RNA binding protein. The encoded protein may play a role in cell division and may be involved in pre-mRNA splicing. Related pseudogenes exist on chromosomes 6, 7, 9, 13, 16, 18, and X. [provided by RefSeq, Mar 2009]

Uniprot Description

RBM22: Involved in the first step of pre-mRNA splicing. Binds directly to the internal stem-loop (ISL) domain of the U6 snRNA and to the pre-mRNA intron near the 5' splice site during the activation and catalytic phases of the spliceosome cycle. Involved in both translocations of the nuclear SLU7 to the cytoplasm and the cytosolic calcium-binding protein PDCD6 to the nucleus upon cellular stress responses. Belongs to the SLT11 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA splicing; RNA-binding; Spliceosome; RNA processing

Chromosomal Location of Human Ortholog: 5q33.1

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: calcium-dependent protein binding; nucleocytoplasmic transporter activity; protein binding; U6 snRNA binding

Biological Process: nuclear mRNA cis splicing, via U2-type spliceosome; nuclear mRNA splicing, via spliceosome; positive regulation of RNA splicing; protein import into nucleus, translocation; spliceosomal snRNP biogenesis

Research Articles on RBM22

Similar Products

Product Notes

The RBM22 rbm22 (Catalog #AAA1271826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacct ctctgggttc caacacctac aacaggcaga actgggagga tgcggacttc cccattctgt gccagacatg tcttggagaa aacccatata tccgaatgac caaagaaaag tatgggaagg aatgcaaaat ctgtgccagg ccattcacag tgtttcgctg gtgccctgga gtccgcatgc gtttcaagaa gactgaagtg tgccaaacct gcagtaaatt gaagaatgtc tgtcagacct gcctcttaga cctagagtat ggcctgccca tccaggttcg tgacgcagga ttgtctttta aagatgacat gccaaagtca gatgtcaaca aagagtacta tacacagaat atggagagag agatttctaa ctctgatgga acacggccag ttggcatgct ggggaaagcc acatctacca gtgacatgct gctcaaactg gcccggacca caccctacta caaaaggaat cgaccccaca tttgctcctt ctgggtgaaa ggagagtgta agagaggaga ggaatgtcca tacagacatg agaagcctac agatccagat gacccccttg ctgatcagaa tattaaagac cgttattacg gaatcaatga tcctgtagct gacaagcttc taaagcgggc ttcaacaatg cctcggctgg acccaccaga ggataaaact atcaccacac tatatgttgg tggtctaggt gataccatta ctgagacaga tttaagaaat catttctacc agttcggaga gatccggacg atcactgttg tgcagagaca gcagtgtgct ttcatccagt ttgccacacg gcaggctgca gaagtggctg ctgagaagtc ctttaataag ttgattgtaa atggccgcag actgaatgtg aaatggggaa gatcccaggc agccagagga aaagaaaaag agaaagatgg aactacagac tctgggatca aactagaacc tgttccagga ttgccaggag ctcttcctcc tcctcctgca gcagaagaag aagcctctgc caactacttc aacttgcccc caagtggtcc tccagctgtg gtgaacattg ctctgccacc gccccctggc attgctccac ccccaccccc aggttttggg ccacacatgt tccacccaat gggaccaccc cctcctttca tgcgggctcc aggaccaatc cactatcctt ctcaggaccc tcagaggatg ggagctcatg ctggaaaaca cagcagcccc tag. It is sometimes possible for the material contained within the vial of "RBM22, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.