Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBM15 cdna clone

RBM15 cDNA Clone

Gene Names
RBM15; OTT; OTT1; SPEN
Synonyms
RBM15; RBM15 cDNA Clone; RBM15 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagggaaaagagcgctcgccagtgaaggccaaacgctcccgtggtggtgaggactcgacttcccgcggtgagcggagcaagaagttagggggctctggtggcagcaatgggagcagcagcggaaagaccgatagcggcggtgggtcgcggcggagtctccacctggacaagtccagcagtcgaggtggcagccgcgagtatgataccggtgggggcagctccagtagccgcttgcatagttatagctccccgagcaccaaaaattcttcgggcgggggcgagtcgcgcagcagctcccggggtggaggcggggagtcacgttcctctggggccgcctcctcagctcccggcggcggggacggcgcggaatacaagactctgaagataagcgagttggggtcccagcttagtgacgaagcggtggaggacggcctgtttcatgagttcaaacgcttcggtgatgtaagtgtgaaaatcagtcatctgtcgggttctggcagcggggatgagcgggtagcctttgtgaacttccggcggccagaggacgcgcgggcggccaagcatgccagaggccgcctggtgctctatgaccggcctctgaagatagaagctgtgtatgtgagccggcgccgcagccgctcccctttagacaaagatacttatcctccatcagccagtgtggtcggggcctctgtaggtggtcaccggcacccccctggaggtggtggaggccagagatcactttcccctggtggcgctgctttgggatacagagactaccggctgcagcagttggctcttggccgcctgccccctccacctccgccaccattgcctcgagacctggagagagaaagagactacccgttctatgagagagtgcgccctgcatacagtcttgagccaagggtgggagctggagcaggtgctgctcctttcagagaagtggatgagatttcacccgaggatgatcagcgagctaaccggacgctcttcttgggcaacctagacatcactgtaacggagagtgatttaagaagggcgtttgatcgctttggagtcatcacagaagtagatatcaagaggccttctcgcggccagactagtacttacggctttctcaaatttgagaacttagatatgtctcaccgggccaaattagcaatgtctggcaaaattataattcggaatcctatcaaaattggttatggtaaagctacacccaccacccgcctctgggtgggaggcctgggaccttgggttcctcttgctgccctggcacgagaatttgatcgatttggcaccatacgcaccatagactaccgaaaaggtgatagttgggcatatatccagtatgaaagcctggatgcagcgcatgctgcctggacccatatgcggggcttccctcttggtggcccagatcgacgccttagagtagactttgccgacaccgaacatcgttaccagcagcagtatctgcagcctctgcccttgactcattatgagctggtgacagatgcttttggacatcgggcaccagaccctttgaggggtgctcgggataggacaccacccttactatacagagatcgtgatagggacctttatcctgactctgattgggtgccacccccacccccagtccgagaacgcagcactcggactgcagctacttctgtgcctgcttacgagccactggatagcctagatcgcaggcgggatggttggtccttggaccgggacagaggtgatcgagatctgcccagcagcagagaccagcctaggaagcgaaggctgcctgaggagagtggaggacgtcatctggataggtctcctgagagtgaccgcccacgaaaacgtcactgcgctccttctcctgaccgcagtccagaattgagcagtagccgggatcgttacaacagcgacaatgatcgatcttcccgtcttctcttggaaaggccctctccaatcagagacagacgaggtagtttggagaagagccagggtgacaagcgagaccgtaaaaactctgcatcagctgaacgagataggaagcaccggacaactgctcccactgagggaaaaagccctctgaaaaaagaagaccgctctgatgggagtgcacctagcaccagcactgcttcctccaagctgaagtccccgtcccagaaacaggatggggggacagcccctgtggcatcagcctctcccaaactctgtttggcctggcagggcatgcttctactgaagaacagcaactttccttccaacatgcatctgttgcagggtgacctccaagtggctagtagtcttcttgtggagggttcaactggaggcaaagtggcccagctcaagatcactcagcgtctccgtttggaccagcccaagttggatgaagtaactcgacgcatcaaagtagcagggcccaatggttatgccattcttttggctgtgcctggaagttctgacagccggtcctcctcttcctcagctgcatcagacactgccacttctactcagaggccacttaggaaccttgtgtcctatttaaagcaaaagcaggcagccggggtgatcagcctccctgtggggggcaacaaagacaaggaaaacaccggggtccttcatgccttcccaccttgtgagttctcccagcagttcctggattcccctgccaaggcactggccaaatctgaagaagattacctggtcatgatcattgtccgtgggtttggttttcagataggagttaggtatgagaacaagaagagagaaaacttggcgctgaccctgttatag
Sequence Length
2802
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,701 Da
NCBI Official Full Name
Homo sapiens RNA binding motif protein 15, mRNA
NCBI Official Synonym Full Names
RNA binding motif protein 15
NCBI Official Symbol
RBM15
NCBI Official Synonym Symbols
OTT; OTT1; SPEN
NCBI Protein Information
putative RNA-binding protein 15
UniProt Protein Name
Putative RNA-binding protein 15
UniProt Gene Name
RBM15
UniProt Synonym Gene Names
OTT; OTT1
UniProt Entry Name
RBM15_HUMAN

NCBI Description

Members of the SPEN (Split-end) family of proteins, including RBM15, have repressor function in several signaling pathways and may bind to RNA through interaction with spliceosome components (Hiriart et al., 2005 [PubMed 16129689]).[supplied by OMIM, Feb 2009]

Uniprot Description

RBM15: May be implicated in HOX gene regulation. A chromosomal aberration involving RBM15 may be a cause of acute megakaryoblastic leukemia. Translocation t(1;22)(p13;q13) with MKL1. Although both reciprocal fusion transcripts are detected in acute megakaryoblastic leukemia (AMKL, FAB-M7), the RBM15-MKL1 chimeric protein has all the putative functional domains encoded by each gene and is the candidate oncogene. Belongs to the RRM Spen family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Spliceosome; RNA-binding; Oncoprotein

Chromosomal Location of Human Ortholog: 1p13

Cellular Component: nuclear speck; nucleoplasm

Molecular Function: nucleic acid binding; protein binding

Biological Process: negative regulation of transcription, DNA-dependent; nuclear mRNA splicing, via spliceosome

Research Articles on RBM15

Similar Products

Product Notes

The RBM15 rbm15 (Catalog #AAA1268074) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagggaa aagagcgctc gccagtgaag gccaaacgct cccgtggtgg tgaggactcg acttcccgcg gtgagcggag caagaagtta gggggctctg gtggcagcaa tgggagcagc agcggaaaga ccgatagcgg cggtgggtcg cggcggagtc tccacctgga caagtccagc agtcgaggtg gcagccgcga gtatgatacc ggtgggggca gctccagtag ccgcttgcat agttatagct ccccgagcac caaaaattct tcgggcgggg gcgagtcgcg cagcagctcc cggggtggag gcggggagtc acgttcctct ggggccgcct cctcagctcc cggcggcggg gacggcgcgg aatacaagac tctgaagata agcgagttgg ggtcccagct tagtgacgaa gcggtggagg acggcctgtt tcatgagttc aaacgcttcg gtgatgtaag tgtgaaaatc agtcatctgt cgggttctgg cagcggggat gagcgggtag cctttgtgaa cttccggcgg ccagaggacg cgcgggcggc caagcatgcc agaggccgcc tggtgctcta tgaccggcct ctgaagatag aagctgtgta tgtgagccgg cgccgcagcc gctccccttt agacaaagat acttatcctc catcagccag tgtggtcggg gcctctgtag gtggtcaccg gcacccccct ggaggtggtg gaggccagag atcactttcc cctggtggcg ctgctttggg atacagagac taccggctgc agcagttggc tcttggccgc ctgccccctc cacctccgcc accattgcct cgagacctgg agagagaaag agactacccg ttctatgaga gagtgcgccc tgcatacagt cttgagccaa gggtgggagc tggagcaggt gctgctcctt tcagagaagt ggatgagatt tcacccgagg atgatcagcg agctaaccgg acgctcttct tgggcaacct agacatcact gtaacggaga gtgatttaag aagggcgttt gatcgctttg gagtcatcac agaagtagat atcaagaggc cttctcgcgg ccagactagt acttacggct ttctcaaatt tgagaactta gatatgtctc accgggccaa attagcaatg tctggcaaaa ttataattcg gaatcctatc aaaattggtt atggtaaagc tacacccacc acccgcctct gggtgggagg cctgggacct tgggttcctc ttgctgccct ggcacgagaa tttgatcgat ttggcaccat acgcaccata gactaccgaa aaggtgatag ttgggcatat atccagtatg aaagcctgga tgcagcgcat gctgcctgga cccatatgcg gggcttccct cttggtggcc cagatcgacg ccttagagta gactttgccg acaccgaaca tcgttaccag cagcagtatc tgcagcctct gcccttgact cattatgagc tggtgacaga tgcttttgga catcgggcac cagacccttt gaggggtgct cgggatagga caccaccctt actatacaga gatcgtgata gggaccttta tcctgactct gattgggtgc cacccccacc cccagtccga gaacgcagca ctcggactgc agctacttct gtgcctgctt acgagccact ggatagccta gatcgcaggc gggatggttg gtccttggac cgggacagag gtgatcgaga tctgcccagc agcagagacc agcctaggaa gcgaaggctg cctgaggaga gtggaggacg tcatctggat aggtctcctg agagtgaccg cccacgaaaa cgtcactgcg ctccttctcc tgaccgcagt ccagaattga gcagtagccg ggatcgttac aacagcgaca atgatcgatc ttcccgtctt ctcttggaaa ggccctctcc aatcagagac agacgaggta gtttggagaa gagccagggt gacaagcgag accgtaaaaa ctctgcatca gctgaacgag ataggaagca ccggacaact gctcccactg agggaaaaag ccctctgaaa aaagaagacc gctctgatgg gagtgcacct agcaccagca ctgcttcctc caagctgaag tccccgtccc agaaacagga tggggggaca gcccctgtgg catcagcctc tcccaaactc tgtttggcct ggcagggcat gcttctactg aagaacagca actttccttc caacatgcat ctgttgcagg gtgacctcca agtggctagt agtcttcttg tggagggttc aactggaggc aaagtggccc agctcaagat cactcagcgt ctccgtttgg accagcccaa gttggatgaa gtaactcgac gcatcaaagt agcagggccc aatggttatg ccattctttt ggctgtgcct ggaagttctg acagccggtc ctcctcttcc tcagctgcat cagacactgc cacttctact cagaggccac ttaggaacct tgtgtcctat ttaaagcaaa agcaggcagc cggggtgatc agcctccctg tggggggcaa caaagacaag gaaaacaccg gggtccttca tgccttccca ccttgtgagt tctcccagca gttcctggat tcccctgcca aggcactggc caaatctgaa gaagattacc tggtcatgat cattgtccgt gggtttggtt ttcagatagg agttaggtat gagaacaaga agagagaaaa cttggcgctg accctgttat ag. It is sometimes possible for the material contained within the vial of "RBM15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.