Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBBP8 cdna clone

RBBP8 cDNA Clone

Gene Names
RBBP8; RIM; COM1; CTIP; JWDS; SAE2; SCKL2
Synonyms
RBBP8; RBBP8 cDNA Clone; RBBP8 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacatctcgggaagcagctgtggaagccctaactctgcagatacatctagtgactttaaggacctttggacaaaactaaaagaatgtcatgatagagaagtacaaggtttacaagtaaaagtaaccaagctaaaacaggaacgaatcttagatgcacaaagactagaagaattcttcaccaaaaatcaacagctgagggaacagcagaaagtccttcatgaaaccattaaagttttagaagatcggttaagagcaggcttatgtgatcgctgtgcagtaactgaagaacatatgcggaaaaaacagcaagagtttgaaaatatccggcagcagaatcttaaacttattacagaacttatgaatgaaaggaatactctacaggaagaaaataaaaagctttctgaacaactccagcagaaaattgagaatgatcaacagcatcaagcagctgagcttgaatgtgaggaagacgttattccagattcaccgataacagccttctcattttctggcgttaaccggctacgaagaaaggagaacccccatgtccgatacatagaacaaacacatactaaattggagcactctgtgtgtgcaaatgaaatgagaaaagtttccaagtcttcaactcatccacaacataatcctaatgaaaatgaaattctagtagctgacacttatgaccaaagtcaatctccaatggccaaagcacatggaacaagcagctatacccctgataagtcatcttttaatttagctacagttgttgctgaaacacttggacttggtgttcaagaagaatctgaaactcaaggtcccatgagcccccttggtgatgagctctaccactgtctggaaggaaatcacaagaaacagccttttgaggaatctacaagaaatactgaagatagtttaagattttcagattctacttcaaagactcctcctcaagaagaattacctactcgagtgtcatctcctgtatttggagctacctctagtatcaaaagtggtttagatttgaatacaagtttgtccccttctcttttacagcctgggaaaaaaaaacatctgaaaacactcccttttagcaacacttgtatatctagattagaaaaaactagatcaaaatctgaagatagtgcccttttcacacatcacagtcttgggtctgaagtgaacaagatcattatccagtcatctaataaacagatacttataaataaaaatataagtgaatccctaggtgaacagaataggactgagtacggtaaagattctaacactgataaacatttggagcccctgaaatcattgggaggccgaacatccaaaaggaagaaaactgaggaagaaagtgaacatgaagtaagctgcccccaagcttcttttgataaagaaaatgctttcccttttccaatggataatcagttttccatgaatggagactgtgtgatgtataaacctctggatctgtctgatcgattttcagctattcagcgtcaagagaaaagccaaggaagtgagacttctaaaaacaaatttaggcaagtgactctttatgaggctttgaagaccattccaaagggcttttcctcaagccgtaaggcctcagatggcaactgcacgttgcccaaagattccccaggggagccctgttcacaggaatgcatcatccttcagcccttgaataaatgctctccagacaataaaccatcattacaaataaaagaagaaaatgctgtctttaaaattcctctacgtccacgtgaaagtttggagactgagaatgttttagatgacataaagagtgctggttctcatgagccaataaaaatacaaaccaggtcagaccatggaggatgtgaacttgcatcagttcttcagttaaatccatgtagaactggtaaaataaagtctctacaaaacaaccaagatgtatcctttgaaaatatccagtggagtatagatccgggagcagacctttctcagtataaaatggatgttactgtaatagatacaaaggatggcagtcagtcaaaattaggaggagagacagtggacatggactgtacattggttagtgaaaccgttctcttaaaaatgaagaaacaagagcagaagggagaaaaaagttcaatgctcttttacatagatgaagaaagaaaaatgaatgatagcttggaagatatgtttgatcggacaacacatgaagagtatgaatcctgtttggcagacagtttctcccaagcagcagatgaagaggaggaattgtctactgccacaaagaaactacacactcatggtgataaacaagacaaagtcaagcagaaagcgtttgtggagccgtattttaaaggtgatgaaagagagactagcttgcaaaattttcctcatattgaggtggttcggaaaaaagaggagagaagaaaactgcttgggcacacgtgtaaggaatgtgaaatttattatgcagatatgccagcagaagaaagagaaaagaaattggcttcctgctcaagacaccgattccgctacattccacccaacacaccagagaatttttgggaagttggttttccttccactcagacttgtatggaaagaggttatattaaggaagatcttgatccttgtcctcgtccaaaaagacgtcagccttacaacgcaatattttctccaaaaggcaaggagcagaagacatag
Sequence Length
2709
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
98,434 Da
NCBI Official Full Name
Homo sapiens retinoblastoma binding protein 8, mRNA
NCBI Official Synonym Full Names
RB binding protein 8, endonuclease
NCBI Official Symbol
RBBP8
NCBI Official Synonym Symbols
RIM; COM1; CTIP; JWDS; SAE2; SCKL2
NCBI Protein Information
DNA endonuclease RBBP8
UniProt Protein Name
DNA endonuclease RBBP8
UniProt Gene Name
RBBP8
UniProt Synonym Gene Names
CTIP; CtIP; RBBP-8; RIM; SAE2
UniProt Entry Name
COM1_HUMAN

NCBI Description

The protein encoded by this gene is a ubiquitously expressed nuclear protein. It is found among several proteins that bind directly to retinoblastoma protein, which regulates cell proliferation. This protein complexes with transcriptional co-repressor CTBP. It is also associated with BRCA1 and is thought to modulate the functions of BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. It is suggested that this gene may itself be a tumor suppressor acting in the same pathway as BRCA1. Three transcript variants encoding two different isoforms have been found for this gene. More transcript variants exist, but their full-length natures have not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

CtIP: a transcription factor containing C2H2 zinc fingers. May modulate the functions ascribed to BRCA1 in transcriptional regulation, DNA repair, and/or cell cycle checkpoint control. Interacts with CTBP, with the C-terminal (BRCT) domains of BRCA1, and with the retinoblastoma protein. Abundantly expressed in brain and the immune system and associated with immune system malignancies. Ionizing radiation induces its hyperphosphorylation and dissociation from BRCA1 in an ATM-dependent manner.

Protein type: EC 3.1.-.-; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 18q11.2

Cellular Component: nucleolus; nucleoplasm; nucleus; transcriptional repressor complex

Molecular Function: damaged DNA binding; protein binding; single-stranded DNA specific endodeoxyribonuclease activity

Biological Process: cell cycle checkpoint; DNA double-strand break processing; DNA repair; DNA replication; DNA synthesis during DNA repair; double-strand break repair via homologous recombination; G2/M transition DNA damage checkpoint; nucleotide-excision repair; regulation of transcription from RNA polymerase II promoter; strand displacement

Disease: Jawad Syndrome; Seckel Syndrome 2

Research Articles on RBBP8

Similar Products

Product Notes

The RBBP8 rbbp8 (Catalog #AAA1272831) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacatct cgggaagcag ctgtggaagc cctaactctg cagatacatc tagtgacttt aaggaccttt ggacaaaact aaaagaatgt catgatagag aagtacaagg tttacaagta aaagtaacca agctaaaaca ggaacgaatc ttagatgcac aaagactaga agaattcttc accaaaaatc aacagctgag ggaacagcag aaagtccttc atgaaaccat taaagtttta gaagatcggt taagagcagg cttatgtgat cgctgtgcag taactgaaga acatatgcgg aaaaaacagc aagagtttga aaatatccgg cagcagaatc ttaaacttat tacagaactt atgaatgaaa ggaatactct acaggaagaa aataaaaagc tttctgaaca actccagcag aaaattgaga atgatcaaca gcatcaagca gctgagcttg aatgtgagga agacgttatt ccagattcac cgataacagc cttctcattt tctggcgtta accggctacg aagaaaggag aacccccatg tccgatacat agaacaaaca catactaaat tggagcactc tgtgtgtgca aatgaaatga gaaaagtttc caagtcttca actcatccac aacataatcc taatgaaaat gaaattctag tagctgacac ttatgaccaa agtcaatctc caatggccaa agcacatgga acaagcagct atacccctga taagtcatct tttaatttag ctacagttgt tgctgaaaca cttggacttg gtgttcaaga agaatctgaa actcaaggtc ccatgagccc ccttggtgat gagctctacc actgtctgga aggaaatcac aagaaacagc cttttgagga atctacaaga aatactgaag atagtttaag attttcagat tctacttcaa agactcctcc tcaagaagaa ttacctactc gagtgtcatc tcctgtattt ggagctacct ctagtatcaa aagtggttta gatttgaata caagtttgtc cccttctctt ttacagcctg ggaaaaaaaa acatctgaaa acactccctt ttagcaacac ttgtatatct agattagaaa aaactagatc aaaatctgaa gatagtgccc ttttcacaca tcacagtctt gggtctgaag tgaacaagat cattatccag tcatctaata aacagatact tataaataaa aatataagtg aatccctagg tgaacagaat aggactgagt acggtaaaga ttctaacact gataaacatt tggagcccct gaaatcattg ggaggccgaa catccaaaag gaagaaaact gaggaagaaa gtgaacatga agtaagctgc ccccaagctt cttttgataa agaaaatgct ttcccttttc caatggataa tcagttttcc atgaatggag actgtgtgat gtataaacct ctggatctgt ctgatcgatt ttcagctatt cagcgtcaag agaaaagcca aggaagtgag acttctaaaa acaaatttag gcaagtgact ctttatgagg ctttgaagac cattccaaag ggcttttcct caagccgtaa ggcctcagat ggcaactgca cgttgcccaa agattcccca ggggagccct gttcacagga atgcatcatc cttcagccct tgaataaatg ctctccagac aataaaccat cattacaaat aaaagaagaa aatgctgtct ttaaaattcc tctacgtcca cgtgaaagtt tggagactga gaatgtttta gatgacataa agagtgctgg ttctcatgag ccaataaaaa tacaaaccag gtcagaccat ggaggatgtg aacttgcatc agttcttcag ttaaatccat gtagaactgg taaaataaag tctctacaaa acaaccaaga tgtatccttt gaaaatatcc agtggagtat agatccggga gcagaccttt ctcagtataa aatggatgtt actgtaatag atacaaagga tggcagtcag tcaaaattag gaggagagac agtggacatg gactgtacat tggttagtga aaccgttctc ttaaaaatga agaaacaaga gcagaaggga gaaaaaagtt caatgctctt ttacatagat gaagaaagaa aaatgaatga tagcttggaa gatatgtttg atcggacaac acatgaagag tatgaatcct gtttggcaga cagtttctcc caagcagcag atgaagagga ggaattgtct actgccacaa agaaactaca cactcatggt gataaacaag acaaagtcaa gcagaaagcg tttgtggagc cgtattttaa aggtgatgaa agagagacta gcttgcaaaa ttttcctcat attgaggtgg ttcggaaaaa agaggagaga agaaaactgc ttgggcacac gtgtaaggaa tgtgaaattt attatgcaga tatgccagca gaagaaagag aaaagaaatt ggcttcctgc tcaagacacc gattccgcta cattccaccc aacacaccag agaatttttg ggaagttggt tttccttcca ctcagacttg tatggaaaga ggttatatta aggaagatct tgatccttgt cctcgtccaa aaagacgtca gccttacaac gcaatatttt ctccaaaagg caaggagcag aagacatag. It is sometimes possible for the material contained within the vial of "RBBP8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.