Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RARRES2 cdna clone

RARRES2 cDNA Clone

Gene Names
RARRES2; TIG2; HP10433
Synonyms
RARRES2; RARRES2 cDNA Clone; RARRES2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgacggctgctgatccctctggccctgtggctgggcgcggtgggcgtgggcgtcgccgagctcacggaagcccagcgccggggcctgcaggtggccctggaggaatttcacaagcacccgcccgtgcagtgggccttccaggagaccagtgtggagagcgccgtggacacgcccttcccagctggaatatttgtgaggctggaatttaagctgcagcagacaagctgccggaagagggactggaagaaacccgagtgcaaagtcaggcccaatgggaggaaacggaaatgcctggcctgcatcaaactgggctctgaggacaaagttctgggccggttggtccactgccccatagagacccaagttctgcgggaggctgaggagcaccaggagacccagtgcctcagggtgcagcgggctggtgaggacccccacagcttctacttccctggacagttcgccttctccaaggccctgccccgcagctaa
Sequence Length
492
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,618 Da
NCBI Official Full Name
Homo sapiens retinoic acid receptor responder (tazarotene induced) 2, mRNA
NCBI Official Synonym Full Names
retinoic acid receptor responder 2
NCBI Official Symbol
RARRES2
NCBI Official Synonym Symbols
TIG2; HP10433
NCBI Protein Information
retinoic acid receptor responder protein 2
UniProt Protein Name
Retinoic acid receptor responder protein 2
UniProt Gene Name
RARRES2
UniProt Synonym Gene Names
TIG2
UniProt Entry Name
RARR2_HUMAN

NCBI Description

This gene encodes a secreted chemotactic protein that initiates chemotaxis via the ChemR23 G protein-coupled seven-transmembrane domain ligand. Expression of this gene is upregulated by the synthetic retinoid tazarotene and occurs in a wide variety of tissues. The active protein has several roles, including that as an adipokine and as an antimicrobial protein with activity against bacteria and fungi. [provided by RefSeq, Nov 2014]

Uniprot Description

RARRES2: Inhibited in psoriatic lesions. Activated by tazarotene in skin rafts and in the epidermis of psoriatic lesions.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 7q36.1

Cellular Component: extracellular matrix; extracellular region

Molecular Function: protein binding; receptor binding

Biological Process: embryonic gut development; in utero embryonic development; platelet degranulation; positive regulation of chemotaxis; positive regulation of fat cell differentiation; positive regulation of protein amino acid phosphorylation; regulation of lipid catabolic process; retinoid metabolic process

Research Articles on RARRES2

Similar Products

Product Notes

The RARRES2 rarres2 (Catalog #AAA1273683) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgacggc tgctgatccc tctggccctg tggctgggcg cggtgggcgt gggcgtcgcc gagctcacgg aagcccagcg ccggggcctg caggtggccc tggaggaatt tcacaagcac ccgcccgtgc agtgggcctt ccaggagacc agtgtggaga gcgccgtgga cacgcccttc ccagctggaa tatttgtgag gctggaattt aagctgcagc agacaagctg ccggaagagg gactggaaga aacccgagtg caaagtcagg cccaatggga ggaaacggaa atgcctggcc tgcatcaaac tgggctctga ggacaaagtt ctgggccggt tggtccactg ccccatagag acccaagttc tgcgggaggc tgaggagcac caggagaccc agtgcctcag ggtgcagcgg gctggtgagg acccccacag cttctacttc cctggacagt tcgccttctc caaggccctg ccccgcagct aa. It is sometimes possible for the material contained within the vial of "RARRES2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.