Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RARA cdna clone

RARA cDNA Clone

Gene Names
RARA; RAR; NR1B1
Synonyms
RARA; RARA cDNA Clone; RARA cdna clone
Ordering
For Research Use Only!
Sequence
atgtacgagagtgtagaagtggggggtcccacccctaatcccttcctagtggtggatttttataaccagaaccgggcctgtttgctcccagagaaggggctccccgccccgggtccgtactccaccccgctccggactccgctttggaatggctcaaaccactccattgagacccagagcagcagttctgaagagatagtgcccagccctccctcgccaccccctctaccccgcatctacaagccttgctttgtctgtcaggacaagtcctcaggctaccactatggggtcagcgcctgtgagggctgcaagggcttcttccgccgcagcatccagaagaacatggtgtacacgtgtcaccgggacaagaactgcatcatcaacaaggtgacccggaaccgctgccagtactgccgactgcagaagtgctttgaagtgggcatgtccaaggagtctgtgagaaacgaccgaaacaagaagaagaaggaggtgcccaagcccgagtgctctgagagctacacgctgacgccggaggtgggggagctcattgagaaggtgcgcaaagcgcaccaggaaaccttccctgccctctgccagctgggcaaatacactacgaacaacagctcagaacaacgtgtctctctggacattgacctctgggacaagttcagtgaactctccaccaagtgcatcattaagactgtggagttcgccaagcagctgcccggcttcaccaccctcaccatcgccgaccagatcaccctcctcaaggctgcctgcctggacatcctgatcctgcggatctgcacgcggtacacgcccgagcaggacaccatgaccttctcggacgggctgaccctgaaccggacccagatgcacaacgctggcttcggccccctcaccgacctggtctttgccttcgccaaccagctgctgcccctggagatggatgatgcggagacggggctgctcagcgccatctgcctcatctgcggagaccgccaggacctggagcagccggaccgggtggacatgctgcaggagccgctgctggaggcgctaaaggtctacgtgcggaagcggaggcccagccgcccccacatgttccccaagatgctaatgaagattactgacctgcgaagcatcagcgccaagggggctgagcgggtgatcacgctgaagatggagatcccgggctccatgccgcctctcatccaggaaatgttggagaactcagagggcctggacactctgagcggacagccggggggtggggggcgggacgggggtggcctggcccccccgccaggcagctgtagccccagcctcagccccagctccaacagaagcagcccggccacccactccccgtga
Sequence Length
1374
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,700 Da
NCBI Official Full Name
Homo sapiens retinoic acid receptor, alpha, mRNA
NCBI Official Synonym Full Names
retinoic acid receptor alpha
NCBI Official Symbol
RARA
NCBI Official Synonym Symbols
RAR; NR1B1
NCBI Protein Information
retinoic acid receptor alpha
UniProt Protein Name
Retinoic acid receptor alpha
Protein Family
UniProt Gene Name
RARA
UniProt Synonym Gene Names
NR1B1; RAR-alpha
UniProt Entry Name
RARA_HUMAN

NCBI Description

This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]

Uniprot Description

RARA: is a receptor for retinoic acid, a potent mammalian morphogen and teratogen that has profound effects on vertebrate development. RARA is a member of the nuclear receptor superfamily. Controls cell function by directly regulating gene expression. Its phosphorylation is crucial for transcriptional activity. Aberrations involving RARA may be a cause of acute promyelocytic leukemia. Two splice-variant isoforms have been described.

Protein type: Oncoprotein; DNA-binding; Nuclear receptor; Transcription factor

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: actin cytoskeleton; cell surface; cytoplasm; nuclear chromatin; nucleoplasm; nucleus

Molecular Function: alpha-actinin binding; chromatin DNA binding; enzyme binding; protein binding; protein domain specific binding; protein heterodimerization activity; protein kinase A binding; protein kinase B binding; receptor binding; retinoic acid binding; retinoic acid receptor activity; transcription coactivator activity; transcription corepressor activity; transcription factor activity; transcription factor binding

Biological Process: apoptotic cell clearance; negative regulation of granulocyte differentiation; negative regulation of interferon-gamma production; negative regulation of transcription, DNA-dependent; negative regulation of tumor necrosis factor production; positive regulation of binding; positive regulation of cell cycle; positive regulation of cell proliferation; positive regulation of interleukin-13 production; positive regulation of interleukin-4 production; positive regulation of interleukin-5 production; positive regulation of T-helper 2 cell differentiation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation; response to retinoic acid; retinoic acid receptor signaling pathway; signal transduction; transcription initiation from RNA polymerase II promoter

Disease: Acute Promyelocytic Leukemia

Research Articles on RARA

Similar Products

Product Notes

The RARA rara (Catalog #AAA1278888) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacgaga gtgtagaagt ggggggtccc acccctaatc ccttcctagt ggtggatttt tataaccaga accgggcctg tttgctccca gagaaggggc tccccgcccc gggtccgtac tccaccccgc tccggactcc gctttggaat ggctcaaacc actccattga gacccagagc agcagttctg aagagatagt gcccagccct ccctcgccac cccctctacc ccgcatctac aagccttgct ttgtctgtca ggacaagtcc tcaggctacc actatggggt cagcgcctgt gagggctgca agggcttctt ccgccgcagc atccagaaga acatggtgta cacgtgtcac cgggacaaga actgcatcat caacaaggtg acccggaacc gctgccagta ctgccgactg cagaagtgct ttgaagtggg catgtccaag gagtctgtga gaaacgaccg aaacaagaag aagaaggagg tgcccaagcc cgagtgctct gagagctaca cgctgacgcc ggaggtgggg gagctcattg agaaggtgcg caaagcgcac caggaaacct tccctgccct ctgccagctg ggcaaataca ctacgaacaa cagctcagaa caacgtgtct ctctggacat tgacctctgg gacaagttca gtgaactctc caccaagtgc atcattaaga ctgtggagtt cgccaagcag ctgcccggct tcaccaccct caccatcgcc gaccagatca ccctcctcaa ggctgcctgc ctggacatcc tgatcctgcg gatctgcacg cggtacacgc ccgagcagga caccatgacc ttctcggacg ggctgaccct gaaccggacc cagatgcaca acgctggctt cggccccctc accgacctgg tctttgcctt cgccaaccag ctgctgcccc tggagatgga tgatgcggag acggggctgc tcagcgccat ctgcctcatc tgcggagacc gccaggacct ggagcagccg gaccgggtgg acatgctgca ggagccgctg ctggaggcgc taaaggtcta cgtgcggaag cggaggccca gccgccccca catgttcccc aagatgctaa tgaagattac tgacctgcga agcatcagcg ccaagggggc tgagcgggtg atcacgctga agatggagat cccgggctcc atgccgcctc tcatccagga aatgttggag aactcagagg gcctggacac tctgagcgga cagccggggg gtggggggcg ggacgggggt ggcctggccc ccccgccagg cagctgtagc cccagcctca gccccagctc caacagaagc agcccggcca cccactcccc gtga. It is sometimes possible for the material contained within the vial of "RARA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.