Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAPGEF3 cdna clone

RAPGEF3 cDNA Clone

Gene Names
RAPGEF3; EPAC; EPAC1; bcm910; HSU79275; CAMP-GEFI
Synonyms
RAPGEF3; RAPGEF3 cDNA Clone; RAPGEF3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgttgagaaggatgcaccggccccgaagctgctcctaccagctgctgctggagcaccagcgtccgagctgcatccaggggctgcgctggacaccactcaccaacagcgaggagtccctggatttcagcgagagcctggagcaggcctccacagagcgggtgctcagggctgggaggcagctgcatcggcatctgctggccacctgcccaaacctcatccgagaccggaagtaccaccttaggctctatcggcagtgctgctctggccgggagctggtggatgggatcttggccctgggacttggggtccattcccggagccaagttgtgggaatctgccaggtgctgctggatgaaggtgccctctgccatgtgaaacacgactgggccttccaggaccgagatgcccaattctaccggttccccgggcccgagcccgagcccgtgggaactcatgagatggaggaggagttggccgaagctgtggccctgctctcccagcgggggcctgacgccatgctcactgtggcacttcgaaagcccccaggtcagcgcacggatgaagagctggacctcatctttgaggagctgctgcacatcaaggctgtggcccacctctccaactcggtgaagcgagaattagcggctgttctgctctttgaaccacacagcaaggcagggaccgtgttgttcagccagggggacaagggcacttcgtggtacattatctggaagggatctgtcaacgtggtgacccatggcaaggggctggtgaccaccctgcatgagggagatgattttggacagctggctctggtgaatgatgcaccccgggcagccaccatcatcctgcgagaagacaactgtcatttcctgcgtgtggacaagcaggacttcaaccgtatcatcaaggtgctgctgctggggttggggagggcaggggccattcgtccagagaagtga
Sequence Length
966
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,452 Da
NCBI Official Full Name
Homo sapiens Rap guanine nucleotide exchange factor (GEF) 3, mRNA
NCBI Official Synonym Full Names
Rap guanine nucleotide exchange factor 3
NCBI Official Symbol
RAPGEF3
NCBI Official Synonym Symbols
EPAC; EPAC1; bcm910; HSU79275; CAMP-GEFI
NCBI Protein Information
rap guanine nucleotide exchange factor 3
UniProt Protein Name
Rap guanine nucleotide exchange factor 3
UniProt Gene Name
RAPGEF3
UniProt Synonym Gene Names
CGEF1; EPAC; EPAC1; EPAC 1; cAMP-GEFI
UniProt Entry Name
RPGF3_HUMAN

Uniprot Description

Epac1: Guanine nucleotide exchange factor (GEF) for RAP1A and RAP2A small GTPases that is activated by binding cAMP. Widely expressed with highest levels in adult kidney, heart, thyroid and brain, and fetal kidney. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, misc.

Chromosomal Location of Human Ortholog: 12q13.1

Cellular Component: cortical actin cytoskeleton; filopodium; lamellipodium; membrane; microvillus; plasma membrane

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; protein domain specific binding; Rap guanyl-nucleotide exchange factor activity

Biological Process: cell proliferation; positive regulation of angiogenesis; positive regulation of GTPase activity; positive regulation of peptidyl-serine phosphorylation; positive regulation of protein export from nucleus; positive regulation of stress fiber formation; positive regulation of syncytium formation by plasma membrane fusion; Rap protein signal transduction; regulation of insulin secretion; signal transduction

Research Articles on RAPGEF3

Similar Products

Product Notes

The RAPGEF3 rapgef3 (Catalog #AAA1271680) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttga gaaggatgca ccggccccga agctgctcct accagctgct gctggagcac cagcgtccga gctgcatcca ggggctgcgc tggacaccac tcaccaacag cgaggagtcc ctggatttca gcgagagcct ggagcaggcc tccacagagc gggtgctcag ggctgggagg cagctgcatc ggcatctgct ggccacctgc ccaaacctca tccgagaccg gaagtaccac cttaggctct atcggcagtg ctgctctggc cgggagctgg tggatgggat cttggccctg ggacttgggg tccattcccg gagccaagtt gtgggaatct gccaggtgct gctggatgaa ggtgccctct gccatgtgaa acacgactgg gccttccagg accgagatgc ccaattctac cggttccccg ggcccgagcc cgagcccgtg ggaactcatg agatggagga ggagttggcc gaagctgtgg ccctgctctc ccagcggggg cctgacgcca tgctcactgt ggcacttcga aagcccccag gtcagcgcac ggatgaagag ctggacctca tctttgagga gctgctgcac atcaaggctg tggcccacct ctccaactcg gtgaagcgag aattagcggc tgttctgctc tttgaaccac acagcaaggc agggaccgtg ttgttcagcc agggggacaa gggcacttcg tggtacatta tctggaaggg atctgtcaac gtggtgaccc atggcaaggg gctggtgacc accctgcatg agggagatga ttttggacag ctggctctgg tgaatgatgc accccgggca gccaccatca tcctgcgaga agacaactgt catttcctgc gtgtggacaa gcaggacttc aaccgtatca tcaaggtgct gctgctgggg ttggggaggg caggggccat tcgtccagag aagtga. It is sometimes possible for the material contained within the vial of "RAPGEF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.