Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RACGAP1 cdna clone

RACGAP1 cDNA Clone

Gene Names
RACGAP1; CYK4; ID-GAP; HsCYK-4; MgcRacGAP
Synonyms
RACGAP1; RACGAP1 cDNA Clone; RACGAP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatactatgatgctgaatgtgcggaatctgtttgagcagcttgtgcgccgggtggagattctcagtgaaggaaatgaagtccaatttatccagttggcgaaggactttgaggatttccgtaaaaagtggcagaggactgaccatgagctggggaaatacaaggatcttttgatgaaagcagagactgagcgaagtgctctggatgttaagctgaagcatgcacgtaatcaggtggatgtagagatcaaacggagacagagagctgaggctgactgcgaaaagctggaacgacagattcagctgattcgagagatgctcatgtgtgacacatctggcagcattcaactaagcgaggagcaaaaatcagctctggcttttctcaacagaggccaaccatccagcagcaatgctgggaacaaaagactatcaaccattgatgaatctggttccattttatcagatatcagctttgacaagactgatgaatcactggattgggactcttctttggtgaagactttcaaactgaagaagagagaaaagaggcgctctactagccgacagtttgttgatggtccccctggacctgtaaagaaaactcgttccattggctctgcagtagaccaggggaatgaatccatagttgcaaaaactacagtgactgttcccaatgatggcgggcccatcgaagctgtgtccactattgagactgtgccatattggaccaggagccgaaggaaaacaggtactttacaaccttggaacagtgactccaccctgaacagcaggcagctggagccaagaactgagacagacagtgtgggcacgccacagagtaatggagggatgcgcctgcatgactttgtttctaagacggttattaaacctgaatcctgtgttccatgtggaaagcggataaaatttggcaaattatctctgaagtgtcgagactgtcgtgtggtctctcatccagaatgtcgggaccgctgtccccttccctgcattcctaccctgataggaacacctgtcaagattggagagggaatgctggcagactttgtgtcccagacttctccaatgatcccctccattgttgtgcattgtgtaaatgagattgagcaaagaggtctgactgagacaggcctgtataggatctctggctgtgaccgcacagtaaaagagctgaaagagaaattcctcagagtgaaaactgtacccctcctcagcaaagtggatgatatccatgctatctgtagccttctaaaagactttcttcgaaacctcaaagaacctcttctgacctttcgccttaacagagcctttatggaagcagcagaaatcacagatgaagacaacagcatagctgccatgtaccaagctgttggtgaactgccccaggccaacagggacacattagctttcctcatgattcacttgcagagagtggctcagagtccacatactaaaatggatgttgccaatctggctaaagtctttggccctacaatagtggcccatgctgtgcccaatccagacccagtgacaatgttacaggacatcaagcgtcaacccaaggtggttgagcgcctgctttccttgcctctggagtattggagtcagttcatgatggtggagcaagagaacattgaccccctacatgtcattgaaaactcaaatgccttttcaacaccacagacaccagatattaaagtgagtttactgggacctgtgaccactcctgaacatcagcttctcaagactccttcatctagttccctgtcacagagagtccgttccaccctcaccaagaacactcctagatttgggagcaaaagcaagtctgccactaacctaggacgacaaggcaacttttttgcttctccaatgctcaagtga
Sequence Length
1899
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
71,027 Da
NCBI Official Full Name
Homo sapiens Rac GTPase activating protein 1, mRNA
NCBI Official Synonym Full Names
Rac GTPase activating protein 1
NCBI Official Symbol
RACGAP1
NCBI Official Synonym Symbols
CYK4; ID-GAP; HsCYK-4; MgcRacGAP
NCBI Protein Information
rac GTPase-activating protein 1
UniProt Protein Name
Rac GTPase-activating protein 1
UniProt Gene Name
RACGAP1
UniProt Synonym Gene Names
MgcRacGAP; CYK4; HsCYK-4
UniProt Entry Name
RGAP1_HUMAN

NCBI Description

This gene encodes a GTPase-activating protein (GAP) that is a compoment of the centralspindlin complex. This protein binds activated forms of Rho GTPases and stimulates GTP hydrolysis, which results in negative regulation of Rho-mediated signals. This protein plays a regulatory role in cytokinesis, cell growth, and differentiation. Alternatively spliced transcript variants have been found for this gene. There is a pseudogene for this gene on chromosome 12. [provided by RefSeq, Feb 2016]

Uniprot Description

MgcRacGAP: a rac GTPase activating protein. Plays an important role in cytokinesis by regulating cortical movement through RhoA. Phosphorylation by Aurora B apparently induces GAP activity toward RhoA.

Protein type: GAPs; GAPs, Rac/Rho

Chromosomal Location of Human Ortholog: 12q13.12

Cellular Component: cleavage furrow; cytoplasm; cytosol; extrinsic to internal side of plasma membrane; midbody; nucleoplasm; nucleus; spindle midzone

Molecular Function: alpha-tubulin binding; beta-tubulin binding; gamma-tubulin binding; GTPase activator activity; microtubule binding; phosphatidylinositol-3,4,5-triphosphate binding; protein binding; protein kinase binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; cytokinesis after mitosis; cytokinesis, contractile ring formation; embryonic development; microtubule-based movement; neuroblast proliferation; positive regulation of cytokinesis; regulation of attachment of spindle microtubules to kinetochore; regulation of small GTPase mediated signal transduction; retrograde vesicle-mediated transport, Golgi to ER; spermatogenesis; spindle midzone assembly involved in mitosis; sulfate transport

Research Articles on RACGAP1

Similar Products

Product Notes

The RACGAP1 racgap1 (Catalog #AAA1266440) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatacta tgatgctgaa tgtgcggaat ctgtttgagc agcttgtgcg ccgggtggag attctcagtg aaggaaatga agtccaattt atccagttgg cgaaggactt tgaggatttc cgtaaaaagt ggcagaggac tgaccatgag ctggggaaat acaaggatct tttgatgaaa gcagagactg agcgaagtgc tctggatgtt aagctgaagc atgcacgtaa tcaggtggat gtagagatca aacggagaca gagagctgag gctgactgcg aaaagctgga acgacagatt cagctgattc gagagatgct catgtgtgac acatctggca gcattcaact aagcgaggag caaaaatcag ctctggcttt tctcaacaga ggccaaccat ccagcagcaa tgctgggaac aaaagactat caaccattga tgaatctggt tccattttat cagatatcag ctttgacaag actgatgaat cactggattg ggactcttct ttggtgaaga ctttcaaact gaagaagaga gaaaagaggc gctctactag ccgacagttt gttgatggtc cccctggacc tgtaaagaaa actcgttcca ttggctctgc agtagaccag gggaatgaat ccatagttgc aaaaactaca gtgactgttc ccaatgatgg cgggcccatc gaagctgtgt ccactattga gactgtgcca tattggacca ggagccgaag gaaaacaggt actttacaac cttggaacag tgactccacc ctgaacagca ggcagctgga gccaagaact gagacagaca gtgtgggcac gccacagagt aatggaggga tgcgcctgca tgactttgtt tctaagacgg ttattaaacc tgaatcctgt gttccatgtg gaaagcggat aaaatttggc aaattatctc tgaagtgtcg agactgtcgt gtggtctctc atccagaatg tcgggaccgc tgtccccttc cctgcattcc taccctgata ggaacacctg tcaagattgg agagggaatg ctggcagact ttgtgtccca gacttctcca atgatcccct ccattgttgt gcattgtgta aatgagattg agcaaagagg tctgactgag acaggcctgt ataggatctc tggctgtgac cgcacagtaa aagagctgaa agagaaattc ctcagagtga aaactgtacc cctcctcagc aaagtggatg atatccatgc tatctgtagc cttctaaaag actttcttcg aaacctcaaa gaacctcttc tgacctttcg ccttaacaga gcctttatgg aagcagcaga aatcacagat gaagacaaca gcatagctgc catgtaccaa gctgttggtg aactgcccca ggccaacagg gacacattag ctttcctcat gattcacttg cagagagtgg ctcagagtcc acatactaaa atggatgttg ccaatctggc taaagtcttt ggccctacaa tagtggccca tgctgtgccc aatccagacc cagtgacaat gttacaggac atcaagcgtc aacccaaggt ggttgagcgc ctgctttcct tgcctctgga gtattggagt cagttcatga tggtggagca agagaacatt gaccccctac atgtcattga aaactcaaat gccttttcaa caccacagac accagatatt aaagtgagtt tactgggacc tgtgaccact cctgaacatc agcttctcaa gactccttca tctagttccc tgtcacagag agtccgttcc accctcacca agaacactcc tagatttggg agcaaaagca agtctgccac taacctagga cgacaaggca acttttttgc ttctccaatg ctcaagtga. It is sometimes possible for the material contained within the vial of "RACGAP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.