Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RABGEF1 cdna clone

RABGEF1 cDNA Clone

Gene Names
RABGEF1; RAP1; RABEX5; rabex-5
Synonyms
RABGEF1; RABGEF1 cDNA Clone; RABGEF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagccttaagtctgaacgccgaggaattcatgtggatcaatcggatctcctgtgcaagaaaggatgtggttactacggcaaccctgcctggcagggtttctgctccaagtgctggagggaagagtaccacaaagccaggcagaagcagattcaggaggactgggagctggcggagcgactccagcgggaggaagaagaggcctttgccagcagtcagagcagccaaggggcccaatccctcacattctccaagtttgaagaaaagaaaaccaacgagaagacccgcaaggttaccacagtgaagaaattcttcagtgcatcttccagggtcggatcaaagaaggaaattcaggaagcaaaagctcccagtccttccataaaccggcaaaccagcattgaaacggatagagtgtctaaggagttcatagaatttctcaagaccttccacaagacaggccaagaaatctataaacagaccaagctgtttttggaaggaatgcattacaaaagggatctaagcattgaagaacagtcagagtgtgctcaggatttctaccacaatgtggccgaaaggatgcaaactcgtgggaaagtgcctccagaaagagtcgagaagataatggatcagattgaaaagtacatcatgactcgtctctataaatatgtattctgtccagaaactactgatgatgagaagaaagatcttgccattcaaaagagaatcagagccctgcgctgggttacgcctcagatgctgtgtgtccctgttaatgaagacatcccagaagtgtctgatatggtggtgaaggcgatcacagatatcattgaaatggattccaagcgtgtgcctcgagacaagctggcctgcatcaccaagtgcagcaagcacatcttcaatgccatcaagatcaccaagaatgagccggcgtcagcggatgacttcctccccaccctcatctacattgttttgaagggcaaccccccacgccttcagtctaatatccagtatatcacgcgcttctgcaatccaagccgactgatgactggagaggatggctactatttcaccaatctgtgctgtgctgtggctttcattgagaagctagacgcccagtctttgaatctaagtcaggaggattttgatcgctacatgtctggccagacctctcccaggaagcaagaagctgagagttggtctcctgatgcttgcttaggcgtcaagcaaatgtataagaacttggatctcttgtctcagttgaatgaacgacaagaaaggatcatgaatgaagccaagaaactggaaaaagacctcatagattggacagatggaattgcaagagaagttcaagacatcgttgagaaatacccactggaaattaagcctccgaatcaaccgttagcagctattgactctgaaaacgttgaaaatgataaacttcctccaccactgcaacctcaagtttatgcaggatga
Sequence Length
1476
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,526 Da
NCBI Official Full Name
Homo sapiens RAB guanine nucleotide exchange factor (GEF) 1, mRNA
NCBI Official Synonym Full Names
RAB guanine nucleotide exchange factor 1
NCBI Official Symbol
RABGEF1
NCBI Official Synonym Symbols
RAP1; RABEX5; rabex-5
NCBI Protein Information
rab5 GDP/GTP exchange factor
UniProt Protein Name
Rab5 GDP/GTP exchange factor
UniProt Gene Name
RABGEF1
UniProt Synonym Gene Names
RABEX5
UniProt Entry Name
RABX5_HUMAN

NCBI Description

RABGEF1 forms a complex with rabaptin-5 (RABPT5; MIM 603616) that is required for endocytic membrane fusion, and it serves as a specific guanine nucleotide exchange factor (GEF) for RAB5 (RAB5A; MIM 179512) (Horiuchi et al., 1997 [PubMed 9323142]).[supplied by OMIM, Mar 2010]

Uniprot Description

RABGEF1: Rab effector protein acting as linker between gamma- adaptin, RAB4A or RAB5A. Involved in endocytic membrane fusion and membrane trafficking of recycling endosomes. Stimulates nucleotide exchange on RAB5A. Can act as a ubiquitin ligase. Interacts with RGS14; the interaction is GTP-dependent. Heterodimer with RABEP1. The heterodimer binds RAB4A and RAB5A that have been activated by GTP-binding. Interacts with RAB21, and with 100-fold lower affinity also with RAB22. Binds TSC2, GGA1, GGA2, GGA3, AP1G1 and AP1G2. Interacts with ubiquitinated EGFR. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; GAPs, Rab

Chromosomal Location of Human Ortholog: 7q11.21

Cellular Component: early endosome

Molecular Function: protein binding; Rab GTPase binding; Rab guanyl-nucleotide exchange factor activity

Biological Process: protein targeting to membrane

Research Articles on RABGEF1

Similar Products

Product Notes

The RABGEF1 rabgef1 (Catalog #AAA1269624) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcctta agtctgaacg ccgaggaatt catgtggatc aatcggatct cctgtgcaag aaaggatgtg gttactacgg caaccctgcc tggcagggtt tctgctccaa gtgctggagg gaagagtacc acaaagccag gcagaagcag attcaggagg actgggagct ggcggagcga ctccagcggg aggaagaaga ggcctttgcc agcagtcaga gcagccaagg ggcccaatcc ctcacattct ccaagtttga agaaaagaaa accaacgaga agacccgcaa ggttaccaca gtgaagaaat tcttcagtgc atcttccagg gtcggatcaa agaaggaaat tcaggaagca aaagctccca gtccttccat aaaccggcaa accagcattg aaacggatag agtgtctaag gagttcatag aatttctcaa gaccttccac aagacaggcc aagaaatcta taaacagacc aagctgtttt tggaaggaat gcattacaaa agggatctaa gcattgaaga acagtcagag tgtgctcagg atttctacca caatgtggcc gaaaggatgc aaactcgtgg gaaagtgcct ccagaaagag tcgagaagat aatggatcag attgaaaagt acatcatgac tcgtctctat aaatatgtat tctgtccaga aactactgat gatgagaaga aagatcttgc cattcaaaag agaatcagag ccctgcgctg ggttacgcct cagatgctgt gtgtccctgt taatgaagac atcccagaag tgtctgatat ggtggtgaag gcgatcacag atatcattga aatggattcc aagcgtgtgc ctcgagacaa gctggcctgc atcaccaagt gcagcaagca catcttcaat gccatcaaga tcaccaagaa tgagccggcg tcagcggatg acttcctccc caccctcatc tacattgttt tgaagggcaa ccccccacgc cttcagtcta atatccagta tatcacgcgc ttctgcaatc caagccgact gatgactgga gaggatggct actatttcac caatctgtgc tgtgctgtgg ctttcattga gaagctagac gcccagtctt tgaatctaag tcaggaggat tttgatcgct acatgtctgg ccagacctct cccaggaagc aagaagctga gagttggtct cctgatgctt gcttaggcgt caagcaaatg tataagaact tggatctctt gtctcagttg aatgaacgac aagaaaggat catgaatgaa gccaagaaac tggaaaaaga cctcatagat tggacagatg gaattgcaag agaagttcaa gacatcgttg agaaataccc actggaaatt aagcctccga atcaaccgtt agcagctatt gactctgaaa acgttgaaaa tgataaactt cctccaccac tgcaacctca agtttatgca ggatga. It is sometimes possible for the material contained within the vial of "RABGEF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.