Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB9A cdna clone

RAB9A cDNA Clone

Gene Names
RAB9A; RAB9
Synonyms
RAB9A; RAB9A cDNA Clone; RAB9A cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggaaaatcatcactttttaaagtaattctccttggagatggtggagttgggaagagttcacttatgaacagatatgtaactaataagtttgatacccagctcttccatacaataggtgtggaatttttaaataaagatttggaagtggatggacattttgttaccatgcagatttgggacacggcaggtcaggagcgattccgaagcctgaggacaccattttacagaggttctgactgctgcctgcttacttttagtgtcgatgattcacaaagcttccagaacttaagtaactggaagaaagaattcatatattatgcagatgtgaaagagcctgagagctttccttttgtgattctgggtaacaagattgacataagcgaacggcaggtgtctacagaagaagcccaagcttggtgcagggacaacggcgactatccttattttgaaacaagtgcaaaagatgccacaaatgtggcagcagcctttgaggaagcggttcgaagagttcttgctaccgaggataggtcagatcatttgattcagacagacacagtcaatcttcaccgaaagcccaagcctagctcatcttgctgttga
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,838 Da
NCBI Official Full Name
Homo sapiens RAB9A, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB9A, member RAS oncogene family
NCBI Official Symbol
RAB9A
NCBI Official Synonym Symbols
RAB9
NCBI Protein Information
ras-related protein Rab-9A
UniProt Protein Name
Ras-related protein Rab-9A
Protein Family
UniProt Gene Name
RAB9A
UniProt Synonym Gene Names
RAB9
UniProt Entry Name
RAB9A_HUMAN

Uniprot Description

RAB9A: Involved in the transport of proteins between the endosomes and the trans Golgi network. Interacts (preferentially in its GTP-bound form) with GCC2 (via its GRIP domain). Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric; G protein, monomeric, Rab; G protein

Chromosomal Location of Human Ortholog: Xp22.2

Cellular Component: cytosol; late endosome; lysosome; phagocytic vesicle; trans-Golgi network membrane; transport vesicle

Molecular Function: GDP binding; GTP binding; GTPase activity; protein binding

Biological Process: negative regulation by host of symbiont molecular function; positive regulation of exocytosis; regulation of protein localization; retrograde transport, endosome to Golgi

Research Articles on RAB9A

Similar Products

Product Notes

The RAB9A rab9a (Catalog #AAA1278134) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggaa aatcatcact ttttaaagta attctccttg gagatggtgg agttgggaag agttcactta tgaacagata tgtaactaat aagtttgata cccagctctt ccatacaata ggtgtggaat ttttaaataa agatttggaa gtggatggac attttgttac catgcagatt tgggacacgg caggtcagga gcgattccga agcctgagga caccatttta cagaggttct gactgctgcc tgcttacttt tagtgtcgat gattcacaaa gcttccagaa cttaagtaac tggaagaaag aattcatata ttatgcagat gtgaaagagc ctgagagctt tccttttgtg attctgggta acaagattga cataagcgaa cggcaggtgt ctacagaaga agcccaagct tggtgcaggg acaacggcga ctatccttat tttgaaacaa gtgcaaaaga tgccacaaat gtggcagcag cctttgagga agcggttcga agagttcttg ctaccgagga taggtcagat catttgattc agacagacac agtcaatctt caccgaaagc ccaagcctag ctcatcttgc tgttga. It is sometimes possible for the material contained within the vial of "RAB9A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.