Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB7L1 cdna clone

RAB7L1 cDNA Clone

Gene Names
RAB29; RAB7L; RAB7L1
Synonyms
RAB7L1; RAB7L1 cDNA Clone; RAB7L1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcagccgcgaccacctgttcaaagtgctggtggtgggggacgccgcagtgggcaagacgtcgctggtgcagcgatattcccaggacagcttcagcaaacactacaagtccacggtgggagtggattttgctctgaaggttctccagtggtctgactacgagatagtgcggcttcagctgtgggatattgcagggcaggagcgcttcacctctatgacacgattgtattatcgggatgcctctgcctgtgttattatgtttgacgttaccaatgccactaccttcagcaacagccagaggtggaaacaggacctagacagcaagctcacactacccaatggagagccggtgccctgcctgctcttggccaacaagtgtgatctgtccccttgggcagtgagccgggaccagattgaccggttcagtaaagagaacggtttcacaggttggacagaaacatcagtcaaggagaacaaaaatattaatgaggctatgagagtcctcattgaaaagatgatgagaaattccacagaagatatcatgtctttgtccacccaaggggactacatcaatctacaaaccaagtcctccagctggtcctgctgctag
Sequence Length
612
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,964 Da
NCBI Official Full Name
Homo sapiens RAB7, member RAS oncogene family-like 1, mRNA
NCBI Official Synonym Full Names
RAB29, member RAS oncogene family
NCBI Official Symbol
RAB29
NCBI Official Synonym Symbols
RAB7L; RAB7L1
NCBI Protein Information
ras-related protein Rab-7L1
UniProt Protein Name
Ras-related protein Rab-7L1
UniProt Gene Name
RAB29
UniProt Synonym Gene Names
RAB7L1
UniProt Entry Name
RAB7L_HUMAN

Uniprot Description

RAB29: Belongs to the small GTPase superfamily. Rab family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein; G protein, monomeric; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: cis-Golgi network; cytoplasm; early endosome; Golgi apparatus; melanosome; mitochondrion; recycling endosome; trans-Golgi network

Molecular Function: dynein binding; GDP binding; GTP binding; kinesin binding; protein binding; Rab GTPase binding

Biological Process: ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; melanosome organization and biogenesis; mitochondrion organization and biogenesis; positive regulation of receptor recycling; positive regulation of T cell receptor signaling pathway; response to bacterium; retrograde transport, endosome to Golgi; synaptogenesis; T cell activation

Research Articles on RAB7L1

Similar Products

Product Notes

The RAB7L1 rab29 (Catalog #AAA1272391) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcagcc gcgaccacct gttcaaagtg ctggtggtgg gggacgccgc agtgggcaag acgtcgctgg tgcagcgata ttcccaggac agcttcagca aacactacaa gtccacggtg ggagtggatt ttgctctgaa ggttctccag tggtctgact acgagatagt gcggcttcag ctgtgggata ttgcagggca ggagcgcttc acctctatga cacgattgta ttatcgggat gcctctgcct gtgttattat gtttgacgtt accaatgcca ctaccttcag caacagccag aggtggaaac aggacctaga cagcaagctc acactaccca atggagagcc ggtgccctgc ctgctcttgg ccaacaagtg tgatctgtcc ccttgggcag tgagccggga ccagattgac cggttcagta aagagaacgg tttcacaggt tggacagaaa catcagtcaa ggagaacaaa aatattaatg aggctatgag agtcctcatt gaaaagatga tgagaaattc cacagaagat atcatgtctt tgtccaccca aggggactac atcaatctac aaaccaagtc ctccagctgg tcctgctgct ag. It is sometimes possible for the material contained within the vial of "RAB7L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.