RAB6A cdna clone

RAB6A

Cat. Num. AAA200718

• Gene Names: RAB6A; RAB6
• Synonyms: RAB6A; RAB6; RAB6A cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGTCCACGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGGGAGCAAAGCGTTGGAAAGACATCTTTGATCACCAGATTCATGTATGACAGTTTTGACAACACCTATCAGGCAACAATTGGCATTGACTTTTTATCAAAAACTATGTACTTGGAGGATCGAACAATCAGGCTTCAGCTGTGGGATACTGCGGGTCAGGAACGTTTCCGTAGCCTCATTCCCAGTTACATCCGTGATTCTGCTGCAGCTGTAGTAGTTTACGATATCACAAATGTTAACTCATTCCAGCAAACTACAAAGTGGATTGATGATGTCAGAACAGAAAGAGGAAGTGATGTTATCATCATGCTAGTAGGAAATAAAACAGATCTTGCTGACAAGAGGCAAGTGTCAATTGAGGAGGGAGAGAGGAAAGCCAAAGAGCTGAATGTTATGTTTATTGAAACTAGTGCAAAAGCTGGATACAATGTAAAGCAGCTCTTTCGACGTGTAGCAGCAGCTTTGCCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGGAGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAA; ; Translation Sequence: MSTGGDFGNP LRKFKLVFLG EQSVGKTSLI TRFMYDSFDN TYQATIGIDF LSKTMYLEDRTIRLQLWDTA GQERFRSLIP SYIRDSAAAV VVYDITNVNS FQQTTKWIDD VRTERGSDVIIMLVGNKTDL ADKRQVSIEE GERKAKELNV MFIETSAKAG YNVKQLFRRV AAALPGMESTQDRSREDMID IKLEKPQEQP VSEGGCSC
• Sequence Length: 208

• Species: Human
• Chromosome Location: 11q13.3
• OMIM Reference Number: 179513
• cDNA Size: 627bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for RAB6A cdna clone

RAB6A encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. RAB6A is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. RAB6A is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.

Product Categories/Family for RAB6A cdna clone

Signal Transduction; Transportation

NCBI and Uniprot Product Information

• NCBI GI #: 19923231
• NCBI GeneID: 5870
• NCBI Accession #: NP_002860.2
• NCBI GenBank Nucleotide #: NM_002869.4
• UniProt Accession #: P20340
• NCBI Official Full Name: ras-related protein Rab-6A isoform a
• NCBI Official Synonym Full Names: RAB6A, member RAS oncogene family
• NCBI Official Symbol: RAB6A
• NCBI Official Synonym Symbols: RAB6
• NCBI Protein Information: ras-related protein Rab-6A
• UniProt Protein Name: Ras-related protein Rab-6A
• Protein Family: Ras-related protein
• UniProt Gene Name: RAB6A
• UniProt Synonym Gene Names: RAB6; Rab-6
• UniProt Entry Name: RAB6A_HUMAN

NCBI Description

This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]

Uniprot Description

RAB6A: Protein transport. Regulator of membrane traffic from the Golgi apparatus towards the endoplasmic reticulum (ER). Has a low GTPase activity. Interacts with CCDC64; leads to its accumulation in the pericentrosomal region. Interacts with SCYL1BP1. Interacts with VSP52 and RABGAP1. Interacts with GCC2 (via its GRIP domain). Interacts with RAB6IP1 (via its RUN 1 domain). Isoform 1 interacts with RAB6KIFL. Isoform 2 does not interact with RAB6KIFL. Isoform 1 interacts with BICD1. Isoform 2 interacts with BICD1. Isoform 1 interacts with BICD2. Isoform 2 interacts with BICD2. Interacts with TMF1. Isoform 1 (GTP-bound) interacts with DYNLRB1; the interaction is direct. Isoform 2 (GDP-bound) interacts with DYNLRB1; the interaction is direct. Interacts with PIFO/C1orf88. Ubiquitous. Belongs to the small GTPase superfamily. Rab family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; G protein, monomeric; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 11q13.3

Cellular Component: Golgi membrane; Golgi apparatus; membrane; trans-Golgi network; cytoplasmic vesicle; cytosol

Molecular Function: GTPase activity; protein domain specific binding; protein binding; GDP binding; GTP binding; myosin V binding

Biological Process: antigen processing and presentation; protein localization in Golgi apparatus; retrograde vesicle-mediated transport, Golgi to ER; peptidyl-cysteine methylation; protein targeting to Golgi; Rab protein signal transduction; retrograde transport, endosome to Golgi