Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB4A cdna clone

RAB4A cDNA Clone

Gene Names
RAB4A; RAB4; HRES1; HRES-1; HRES-1/RAB4
Synonyms
RAB4A; RAB4A cDNA Clone; RAB4A cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcagacggccatgtccgaaacctacgattttttgtttaagttcttggttattggaaatgcaggaactggcaaatcttgcttacttcatcagtttattgaaaaaaaattcaaagatgactcaaatcatacaataggagtggaatttggttcaaagataataaatgttggtggtaaatatgtaaagttacaaatatgggatacagcaggacaagaacgattcaggtccgtgacgagaagttattaccgaggcgcggccggggctctcctcgtctatgatatcaccagccgagaaacctacaatgcgcttactaattggttaacagatgcccgaatgctagcgagccagaacattgtgatcatcctttgtggaaacaagaaggacctggatgcagatcgtgaagttaccttcttagaagcctccagatttgctcaagaaaatgagctgatgtttttggaaacaagtgcgctcacaggggagaatgtagaagaggcttttgtacagtgtgcaagaaaaatacttaacaaaatcgaatcaggtgagctggacccagaaagaatgggctcaggtattcagtacggagatgctgccttgagacagctgaggtcaccgcggcgcgcacaggccccgaacgctcaggagtgtggttgttag
Sequence Length
657
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,390 Da
NCBI Official Full Name
Homo sapiens RAB4A, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB4A, member RAS oncogene family
NCBI Official Symbol
RAB4A
NCBI Official Synonym Symbols
RAB4; HRES1; HRES-1; HRES-1/RAB4
NCBI Protein Information
ras-related protein Rab-4A
UniProt Protein Name
Ras-related protein Rab-4A
Protein Family
UniProt Gene Name
RAB4A
UniProt Synonym Gene Names
RAB4
UniProt Entry Name
RAB4A_HUMAN

NCBI Description

This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]

Uniprot Description

Rab4: a member of the RAB family of RAS-related GTP-binding proteins, important regulators of vesicular transport and are located in specific intracellular compartments. RAB7 has been localized to late endosomes and shown to be important in the late endocytic pathway. In addition, it has been shown to have a fundamental role in the cellular vacuolation induced by the cytotoxin VacA of Helicobacter pylori. Mutations in this protein cause Charcot-Marie-Tooth type 2B neuropathy.

Protein type: G protein; G protein, monomeric; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 1q42-q43

Cellular Component: endosome; perinuclear region of cytoplasm; vesicle

Molecular Function: GDP binding; GTP binding; GTPase activity; protein binding

Biological Process: antigen processing and presentation; regulation of endocytosis

Research Articles on RAB4A

Similar Products

Product Notes

The RAB4A rab4a (Catalog #AAA1276609) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcaga cggccatgtc cgaaacctac gattttttgt ttaagttctt ggttattgga aatgcaggaa ctggcaaatc ttgcttactt catcagttta ttgaaaaaaa attcaaagat gactcaaatc atacaatagg agtggaattt ggttcaaaga taataaatgt tggtggtaaa tatgtaaagt tacaaatatg ggatacagca ggacaagaac gattcaggtc cgtgacgaga agttattacc gaggcgcggc cggggctctc ctcgtctatg atatcaccag ccgagaaacc tacaatgcgc ttactaattg gttaacagat gcccgaatgc tagcgagcca gaacattgtg atcatccttt gtggaaacaa gaaggacctg gatgcagatc gtgaagttac cttcttagaa gcctccagat ttgctcaaga aaatgagctg atgtttttgg aaacaagtgc gctcacaggg gagaatgtag aagaggcttt tgtacagtgt gcaagaaaaa tacttaacaa aatcgaatca ggtgagctgg acccagaaag aatgggctca ggtattcagt acggagatgc tgccttgaga cagctgaggt caccgcggcg cgcacaggcc ccgaacgctc aggagtgtgg ttgttag. It is sometimes possible for the material contained within the vial of "RAB4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.