RAB40A cdna clone
RAB40A cDNA Clone
Gene Names
RAB40A; RAR2; RAR2A
Synonyms
RAB40A; RAB40A cDNA Clone; RAB40A cdna clone
Sequence
atgagcgccccgggcagccccgaccaggcctatgacttcctgctcaagttcctgctggtgggcgacagggacgtaggcaagagtgagatcctggagagcctgcaggatggtgcagctgagtccccgtacagccatctcggggggatcgactacaagacgaccaccatcctgctggacggccagcgggtgaagctgaagctctgggatacgtcggggcagggaagattttgtaccatattccgctcctactctcgtggtgcacaaggagtgatcctggtctacgacattgcaaaccgctggtctttcgagggtatggatcgatggattaagaagattgaggaacatgcccctggtgtccctaaaatcctggtggggaatcgcctacatctggcattcaagaggcaggtgcccagggagcaggcccaggcctacgccgagcgcctgggtgtgaccttctttgaggtcagccctctgtgcaatttcaacatcatagagtctttcacggagctggccaggatagtgctgctgcggcacaggatgaattggctcgggaggccgagcaaggtactgagcttgcaagacctctgctgccgcaccatcgtgtcctgcacacctgtgcatctggtggacaagctcccgctccccagtaccttaagaagccacctcaagtccttctccatggctaagggcctgaatgccaggatgatgcgaggcctctcctactccctcaccaccagctccactcacaagagcagcctctgcaaagtggagatcgtctgcccaccccagagcccacccaaaaactgcaccagaaacagctgcaaaatttcttaa
Sequence Length
834
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
31,076 Da
NCBI Official Full Name
Homo sapiens RAB40A, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB40A, member RAS oncogene family
NCBI Official Symbol
RAB40A
NCBI Official Synonym Symbols
RAR2; RAR2A
NCBI Protein Information
ras-related protein Rab-40A
UniProt Protein Name
Ras-related protein Rab-40A
Protein Family
UniProt Gene Name
RAB40A
UniProt Synonym Gene Names
Protein Rar-2
UniProt Entry Name
RB40A_HUMAN
NCBI Description
This gene encodes a member of the Rab40 subfamily of Rab small GTP-binding proteins that contains a C-terminal suppressors of cytokine signaling box. [provided by RefSeq, Apr 2010]
Uniprot Description
RAB40A: May be a substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Belongs to the small GTPase superfamily. Rab family.
Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab
Chromosomal Location of Human Ortholog: Xq22.1
Similar Products
Product Notes
The RAB40A rab40a (Catalog #AAA1274280) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcgccc cgggcagccc cgaccaggcc tatgacttcc tgctcaagtt cctgctggtg ggcgacaggg acgtaggcaa gagtgagatc ctggagagcc tgcaggatgg tgcagctgag tccccgtaca gccatctcgg ggggatcgac tacaagacga ccaccatcct gctggacggc cagcgggtga agctgaagct ctgggatacg tcggggcagg gaagattttg taccatattc cgctcctact ctcgtggtgc acaaggagtg atcctggtct acgacattgc aaaccgctgg tctttcgagg gtatggatcg atggattaag aagattgagg aacatgcccc tggtgtccct aaaatcctgg tggggaatcg cctacatctg gcattcaaga ggcaggtgcc cagggagcag gcccaggcct acgccgagcg cctgggtgtg accttctttg aggtcagccc tctgtgcaat ttcaacatca tagagtcttt cacggagctg gccaggatag tgctgctgcg gcacaggatg aattggctcg ggaggccgag caaggtactg agcttgcaag acctctgctg ccgcaccatc gtgtcctgca cacctgtgca tctggtggac aagctcccgc tccccagtac cttaagaagc cacctcaagt ccttctccat ggctaagggc ctgaatgcca ggatgatgcg aggcctctcc tactccctca ccaccagctc cactcacaag agcagcctct gcaaagtgga gatcgtctgc ccaccccaga gcccacccaa aaactgcacc agaaacagct gcaaaatttc ttaa. It is sometimes possible for the material contained within the vial of "RAB40A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
