Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB31 cdna clone

RAB31 cDNA Clone

Gene Names
RAB31; Rab22B
Synonyms
RAB31; RAB31 cDNA Clone; RAB31 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggcgatacgggagctcaaagtgtgccttctcggggacactggggttgggaaatcaagcatcgtgtgtcgatttgtccaggatcactttgaccacaacatcagccctactattggggcatcttttatgaccaaaactgtgccttgtggaaatgaacttcacaagttcctcatctgggacactgctggtcaggaacggtttcattcattggctcccatgtactatcgaggctcagctgcagctgttatcgtgtatgatattaccaagcaggattcattttataccttgaagaaatgggtcaaggagctgaaagaacatggtccagaaaacattgtaatggccatcgctggaaacaagtgcgacctctcagatattagggaggttcccctgaaggatgctaaggaatacgctgaatccataggtgccatcgtggttgagacaagtgcaaaaaatgctattaatatcgaagagctctttcaaggaatcagccgccagatcccacccttggacccccatgaaaatggaaacaatggaacaatcaaagttgagaagccaaccatgcaagccagccgccggtgctgttga
Sequence Length
588
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,569 Da
NCBI Official Full Name
Homo sapiens RAB31, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB31, member RAS oncogene family
NCBI Official Symbol
RAB31
NCBI Official Synonym Symbols
Rab22B
NCBI Protein Information
ras-related protein Rab-31
UniProt Protein Name
Ras-related protein Rab-31
Protein Family
UniProt Gene Name
RAB31
UniProt Synonym Gene Names
RAB22B
UniProt Entry Name
RAB31_HUMAN

NCBI Description

Small GTP-binding proteins of the RAB family, such as RAB31, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]).[supplied by OMIM, Jul 2009]

Uniprot Description

RAB31: Belongs to the small GTPase superfamily. Rab family

Protein type: G protein; G protein, monomeric, Rab; G protein, monomeric

Chromosomal Location of Human Ortholog: 18p11.3

Cellular Component: early endosome; phagocytic vesicle; trans-Golgi network membrane

Molecular Function: GDP binding; GTP binding; GTPase activity

Biological Process: cellular response to insulin stimulus; Golgi to plasma membrane protein transport; receptor internalization; regulated secretory pathway

Research Articles on RAB31

Similar Products

Product Notes

The RAB31 rab31 (Catalog #AAA1275051) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggcga tacgggagct caaagtgtgc cttctcgggg acactggggt tgggaaatca agcatcgtgt gtcgatttgt ccaggatcac tttgaccaca acatcagccc tactattggg gcatctttta tgaccaaaac tgtgccttgt ggaaatgaac ttcacaagtt cctcatctgg gacactgctg gtcaggaacg gtttcattca ttggctccca tgtactatcg aggctcagct gcagctgtta tcgtgtatga tattaccaag caggattcat tttatacctt gaagaaatgg gtcaaggagc tgaaagaaca tggtccagaa aacattgtaa tggccatcgc tggaaacaag tgcgacctct cagatattag ggaggttccc ctgaaggatg ctaaggaata cgctgaatcc ataggtgcca tcgtggttga gacaagtgca aaaaatgcta ttaatatcga agagctcttt caaggaatca gccgccagat cccacccttg gacccccatg aaaatggaaa caatggaaca atcaaagttg agaagccaac catgcaagcc agccgccggt gctgttga. It is sometimes possible for the material contained within the vial of "RAB31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.