Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB23 cdna clone

RAB23 cDNA Clone

Gene Names
RAB23; HSPC137
Synonyms
RAB23; RAB23 cDNA Clone; RAB23 cdna clone
Ordering
For Research Use Only!
Sequence
atgttggaggaagatatggaagtcgccataaagatggtggttgtagggaatggagcagttggaaaatcaagtatgattcagcgatattgcaaaggcatttttacaaaagactacaagaaaaccattggagttgattttttggagcgacaaattcaagttaatgatgaagatgtcagactaatgttatgggacactgcaggtcaggaggaatttgatgcaattacaaaggcctactatcgaggagcccaggcttgtgtgctcgtgttctctaccacagatagggaatcttttgaagcagtttccagttggagagagaaagtagtagccgaagtgggagatataccaactgtacttgtgcaaaacaagattgatcttctggatgattcttgtataaagaatgaggaagctgaggcactggcaaaaaggttaaagttaagattctacagaacatcagtgaaagaagatctaaatgtgaatgaagtttttaagtatttggctgaaaaataccttcagaaactcaaacaacaaatagctgaggatccagaactaacgcattcaagtagtaacaagattggtgtctttaatacatctggtggaagtcactccggtcagaattcaggtaccctcaatggtggagatgtcatcaatcttagacccaacaaacaaaggaccaagaaaaacagaaatccttttagcagctgtagcataccctaa
Sequence Length
714
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,659 Da
NCBI Official Full Name
Homo sapiens RAB23, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB23, member RAS oncogene family
NCBI Official Symbol
RAB23
NCBI Official Synonym Symbols
HSPC137
NCBI Protein Information
ras-related protein Rab-23
UniProt Protein Name
Ras-related protein Rab-23
Protein Family
UniProt Gene Name
RAB23
UniProt Entry Name
RAB23_HUMAN

NCBI Description

This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Uniprot Description

RAB23: Defects in RAB23 are the cause of acrocephalopolysyndactyly type 2 (ACPS2). A syndrome characterized by craniosynostosis, polysyndactyly, obesity, and cardiac defects. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric; G protein, monomeric, Rab; G protein

Chromosomal Location of Human Ortholog: 6p11

Cellular Component: autophagic vacuole; cytoplasm; endosome membrane; phagocytic vesicle; plasma membrane

Molecular Function: GTPase activity; protein binding

Biological Process: autophagic vacuole formation; cellular defense response; cilium biogenesis; negative regulation of transcription factor import into nucleus

Disease: Carpenter Syndrome 1

Research Articles on RAB23

Similar Products

Product Notes

The RAB23 rab23 (Catalog #AAA1265874) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggagg aagatatgga agtcgccata aagatggtgg ttgtagggaa tggagcagtt ggaaaatcaa gtatgattca gcgatattgc aaaggcattt ttacaaaaga ctacaagaaa accattggag ttgatttttt ggagcgacaa attcaagtta atgatgaaga tgtcagacta atgttatggg acactgcagg tcaggaggaa tttgatgcaa ttacaaaggc ctactatcga ggagcccagg cttgtgtgct cgtgttctct accacagata gggaatcttt tgaagcagtt tccagttgga gagagaaagt agtagccgaa gtgggagata taccaactgt acttgtgcaa aacaagattg atcttctgga tgattcttgt ataaagaatg aggaagctga ggcactggca aaaaggttaa agttaagatt ctacagaaca tcagtgaaag aagatctaaa tgtgaatgaa gtttttaagt atttggctga aaaatacctt cagaaactca aacaacaaat agctgaggat ccagaactaa cgcattcaag tagtaacaag attggtgtct ttaatacatc tggtggaagt cactccggtc agaattcagg taccctcaat ggtggagatg tcatcaatct tagacccaac aaacaaagga ccaagaaaaa cagaaatcct tttagcagct gtagcatacc ctaa. It is sometimes possible for the material contained within the vial of "RAB23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.