RAB1A cdna clone

RAB1A cDNA Clone

Cat. Num. AAA1267709

• Gene Names: RAB1A; RAB1; YPT1
• Synonyms: RAB1A; RAB1A cDNA Clone; RAB1A cdna clone

• Sequence: atgtccagcatgaatcccgaatatgattatttattcaagttacttctgattggcgactcaggggttggaaagtcttgccttcttcttaggtttgcagatgatacatatacagaaagctacatcagcacaattggtgtggatttcaaaataagaactatagagttagacgggaaaacaatcaagcttcaaatatgggacacagcaggccaggaaagatttcgaacaatcacctccagttattacagaggagcccatggcatcatagttgtgtatgatgtgacagatcaggagtccttcaataatgttaaacagtggctgcaggaaatagatcgttatgccagtgaaaatgtcaacaaattgttggtagggaacaaatgtgatctgaccacaaagaaagtagtagactacacaacagcgaaggaatttgctgattcccttggaattccgtttttggaaaccagtgctaagaatgcaacgaatgtagaacagtctttcatgacgatggcagctgagattaaaaagcgaatgggtcccggagcaacagctggtggtgctgagaagtccaatgttaaaattcagagcactccagtcaagcagtcaggtggaggttgctgctaa
• Sequence Length: 618

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 14705268
• NCBI GeneID: 5861
• Molecular Weight: 13,903 Da
• NCBI Official Full Name: Homo sapiens RAB1A, member RAS oncogene family, mRNA
• NCBI Official Synonym Full Names: RAB1A, member RAS oncogene family
• NCBI Official Symbol: RAB1A
• NCBI Official Synonym Symbols: RAB1; YPT1
• NCBI Protein Information: ras-related protein Rab-1A
• UniProt Protein Name: Ras-related protein Rab-1A
• Protein Family: Ras-related protein
• UniProt Gene Name: RAB1A
• UniProt Synonym Gene Names: RAB1
• UniProt Entry Name: RAB1A_HUMAN

NCBI Description

This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. [provided by RefSeq, Oct 2008]

Uniprot Description

RAB1A: Probably required for transit of protein from the ER through Golgi compartment. Binds GTP and GDP and possesses intrinsic GTPase activity. Belongs to the small GTPase superfamily. Rab family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein, monomeric; G protein, monomeric, Rab; G protein

Chromosomal Location of Human Ortholog: 2p14

Cellular Component: cell-cell adherens junction; cytosol; endoplasmic reticulum membrane; Golgi apparatus; Golgi membrane

Molecular Function: GTPase activity; protein binding

Biological Process: autophagic vacuole formation; autophagy; cell migration; cilium biogenesis; COPII coating of Golgi vesicle; defense response to bacterium; endocytosis; ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; growth hormone secretion; retrograde vesicle-mediated transport, Golgi to ER; vesicle transport along microtubule; vesicle-mediated transport; virus assembly