Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

QTRT1 cdna clone

QTRT1 cDNA Clone

Gene Names
QTRT1; TGT; TGUT; FP3235
Synonyms
QTRT1; QTRT1 cDNA Clone; QTRT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagtgggcacgcaggccaccatgaagggcatcacgaccgaacagctggacgctctgggttgccgcatctgcctgggcaatacctaccatctgggtctaaggccgggacccgagctgatccagaaagccaacggtctccacggcttcatgaattggcctcataatctgctaacggacagcggcggtttccagatggtgtcgctggtgtctctgtccgaggtgacggaggagggcgtccgcttccgctccccctacgacggcaatgagaccctgctgagcccggagaaatccgtgcagatccagaatgcgctgggctcggacatcatcatgcagctggacgacgtggttagcagtactgtgactgggccacgtgtggaggaggccatgtacaggtcaatccgctggctggaccggtgcattgcagcccatcagcggccggacaagcagaacctcttcgccattatccagggtgggctggacgcagatctccgggccacctgccttgaagagatgaccaagcgagacgtgcctggcttcgccatcgggggcctgagcgggggtgagagcaagtcgcagttctggcggatggtggcgctgagcacctctcggctgccgaaggacaagccccgatatctgatgggggttggctatgccactgatctggtagtctgcgtggctcttggatgtgacatgttcgactgcgtcttccccacacggacagcgcgctttggctctgccctggtgcccactgggaacctgcagttgaggaagaaggtgtttgagaaggacttcggccccatagacccggagtgcacctgccccacgtgccaaaagcacagccgcgccttcctgcacgcactgctgcacagtgacaacacggccgcgctgcaccacctcacggtccacaacatcgcctaccagctgcagctcatgagcgccgtccgcaccagcatcgtggagaagcgcttcccggacttcgtgcgggacttcatgggcgccatgtacggggatcccaccctctgtcccacctgggccactgacgctctggcctctgtgggaatcacactgggctga
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,015 Da
NCBI Official Full Name
Homo sapiens queuine tRNA-ribosyltransferase 1, mRNA
NCBI Official Synonym Full Names
queuine tRNA-ribosyltransferase catalytic subunit 1
NCBI Official Symbol
QTRT1
NCBI Official Synonym Symbols
TGT; TGUT; FP3235
NCBI Protein Information
queuine tRNA-ribosyltransferase
UniProt Protein Name
Queuine tRNA-ribosyltransferase
UniProt Gene Name
QTRT1
UniProt Synonym Gene Names
TGT; TGUT
UniProt Entry Name
TGT_HUMAN

NCBI Description

This gene encodes the catalytic subunit of tRNA-guanine transglycosylase. tRNA-guanine transglycosylase is a heterodimeric enzyme complex that plays a critical role in tRNA modification by synthesizing the 7-deazaguanosine queuosine, which is found in tRNAs that code for asparagine, aspartic acid, histidine and tyrosine. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, Feb 2012]

Uniprot Description

QTRT1: Interacts with QTRTD1 to form an active queuine tRNA- ribosyltransferase. This enzyme exchanges queuine for the guanine at the wobble position of tRNAs with GU(N) anticodons (tRNA-Asp, -Asn, -His and -Tyr), thereby forming the hypermodified nucleoside queuosine (Q) (7-(((4,5-cis-dihydroxy-2-cyclopenten-1- yl)amino)methyl)-7-deazaguanosine). Belongs to the queuine tRNA-ribosyltransferase family.

Protein type: RNA processing; EC 2.4.2.29; Transferase; Mitochondrial

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; mitochondrial outer membrane

Molecular Function: protein heterodimerization activity; protein homodimerization activity; queuine tRNA-ribosyltransferase activity

Biological Process: queuosine biosynthetic process; tRNA modification

Research Articles on QTRT1

Similar Products

Product Notes

The QTRT1 qtrt1 (Catalog #AAA1268283) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagtgg gcacgcaggc caccatgaag ggcatcacga ccgaacagct ggacgctctg ggttgccgca tctgcctggg caatacctac catctgggtc taaggccggg acccgagctg atccagaaag ccaacggtct ccacggcttc atgaattggc ctcataatct gctaacggac agcggcggtt tccagatggt gtcgctggtg tctctgtccg aggtgacgga ggagggcgtc cgcttccgct ccccctacga cggcaatgag accctgctga gcccggagaa atccgtgcag atccagaatg cgctgggctc ggacatcatc atgcagctgg acgacgtggt tagcagtact gtgactgggc cacgtgtgga ggaggccatg tacaggtcaa tccgctggct ggaccggtgc attgcagccc atcagcggcc ggacaagcag aacctcttcg ccattatcca gggtgggctg gacgcagatc tccgggccac ctgccttgaa gagatgacca agcgagacgt gcctggcttc gccatcgggg gcctgagcgg gggtgagagc aagtcgcagt tctggcggat ggtggcgctg agcacctctc ggctgccgaa ggacaagccc cgatatctga tgggggttgg ctatgccact gatctggtag tctgcgtggc tcttggatgt gacatgttcg actgcgtctt ccccacacgg acagcgcgct ttggctctgc cctggtgccc actgggaacc tgcagttgag gaagaaggtg tttgagaagg acttcggccc catagacccg gagtgcacct gccccacgtg ccaaaagcac agccgcgcct tcctgcacgc actgctgcac agtgacaaca cggccgcgct gcaccacctc acggtccaca acatcgccta ccagctgcag ctcatgagcg ccgtccgcac cagcatcgtg gagaagcgct tcccggactt cgtgcgggac ttcatgggcg ccatgtacgg ggatcccacc ctctgtccca cctgggccac tgacgctctg gcctctgtgg gaatcacact gggctga. It is sometimes possible for the material contained within the vial of "QTRT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.