Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

QPRT cdna clone

QPRT cDNA Clone

Gene Names
QPRT; QPRTase; HEL-S-90n
Synonyms
QPRT; QPRT cDNA Clone; QPRT cdna clone
Ordering
For Research Use Only!
Sequence
atggacgctgaaggcctggcgctgctgctgccgcccgtcaccctggcagccctggtggacagctggctccgagaggactgcccagggctcaactacgcagccttggtcagcggggcaggcccctcgcaggcggcgctgtgggccaaatcccctgggatactggcagggcagcctttcttcgatgccatatttacccaactcaactgccaagtctcctggttcctccccgagggatcgaagctggtgccggtggccagagtggccgaggtccggggccctgcccactgcctgctgctgggggaacgggtggccctcaacacgctggcccgctgcagtggcattgccagtgctgccgccgctgcagtggaggccgccaggggggccggctggactgggcacgtggcaggcacgaggaagaccacgccaggcttccggctggtggagaagtatgggctcctggtgggcggggccgcctcgcaccgctacgacctgggagggctggtgatggtgaaggataaccatgtggtggccgccggtggcgtggagaaggcggtgcgggcggccagacaggcggctgacttcgctctgaaggtggaagtggaatgcagcagcctgcaggaggccgtgcaggcagctgaggctggtgccgaccttgtcctgctggacaacttcaagccagaggagctgcaccccacggccaccgtgctgaaggcccagttcccgagtgtggctgtggaagccagtgggggcatcaccctggacaacctcccccagttctgcgggccgcacatagacgtcatctccatggggatgctgacccaggcggccccagcccttgatttctccctcaagctgtttgccaaagaggtggctccagtgcccaaaatccactag
Sequence Length
894
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,846 Da
NCBI Official Full Name
Homo sapiens quinolinate phosphoribosyltransferase, mRNA
NCBI Official Synonym Full Names
quinolinate phosphoribosyltransferase
NCBI Official Symbol
QPRT
NCBI Official Synonym Symbols
QPRTase; HEL-S-90n
NCBI Protein Information
nicotinate-nucleotide pyrophosphorylase [carboxylating]
UniProt Protein Name
Nicotinate-nucleotide pyrophosphorylase [carboxylating]
UniProt Gene Name
QPRT
UniProt Synonym Gene Names
QAPRTase; QPRTase
UniProt Entry Name
NADC_HUMAN

NCBI Description

This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Uniprot Description

QPRT: Involved in the catabolism of quinolinic acid (QA). Belongs to the NadC/ModD family.

Protein type: EC 2.4.2.19; Transferase; Cofactor and Vitamin Metabolism - nicotinate and nicotinamide

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: cytoplasm; cytosol

Molecular Function: nicotinate-nucleotide diphosphorylase (carboxylating) activity; protein homodimerization activity

Biological Process: NAD biosynthetic process; NAD metabolic process; protein oligomerization

Research Articles on QPRT

Similar Products

Product Notes

The QPRT qprt (Catalog #AAA1274708) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgctg aaggcctggc gctgctgctg ccgcccgtca ccctggcagc cctggtggac agctggctcc gagaggactg cccagggctc aactacgcag ccttggtcag cggggcaggc ccctcgcagg cggcgctgtg ggccaaatcc cctgggatac tggcagggca gcctttcttc gatgccatat ttacccaact caactgccaa gtctcctggt tcctccccga gggatcgaag ctggtgccgg tggccagagt ggccgaggtc cggggccctg cccactgcct gctgctgggg gaacgggtgg ccctcaacac gctggcccgc tgcagtggca ttgccagtgc tgccgccgct gcagtggagg ccgccagggg ggccggctgg actgggcacg tggcaggcac gaggaagacc acgccaggct tccggctggt ggagaagtat gggctcctgg tgggcggggc cgcctcgcac cgctacgacc tgggagggct ggtgatggtg aaggataacc atgtggtggc cgccggtggc gtggagaagg cggtgcgggc ggccagacag gcggctgact tcgctctgaa ggtggaagtg gaatgcagca gcctgcagga ggccgtgcag gcagctgagg ctggtgccga ccttgtcctg ctggacaact tcaagccaga ggagctgcac cccacggcca ccgtgctgaa ggcccagttc ccgagtgtgg ctgtggaagc cagtgggggc atcaccctgg acaacctccc ccagttctgc gggccgcaca tagacgtcat ctccatgggg atgctgaccc aggcggcccc agcccttgat ttctccctca agctgtttgc caaagaggtg gctccagtgc ccaaaatcca ctag. It is sometimes possible for the material contained within the vial of "QPRT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.