Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PWP1 cdna clone

PWP1 cDNA Clone

Gene Names
PWP1; IEF-SSP-9502
Synonyms
PWP1; PWP1 cDNA Clone; PWP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccgcagccgccaggtgacgtgcgtggcctgggtccgctgcggcgtggccaaagagacaccagacaaggtagagctgagtaaagaagaagtaaaacgcctcattgctgaggcaaaggagaaattgcaagaagaaggtggtggcagtgatgaagaggagacaggcagtccttcagaagatggcatgcagagtgcacgcacccaggcacgcccaagagagcccctggaggatggtgacccagaggatgacaggacgcttgatgatgatgagctggctgagtacgacttagataaatatgatgaggaaggtgacccagatgctgagactcttggtgaatctctcttgggtcttacggtctacgggagtaatgatcaagatccttacgttactctgaaagatacatcaatgacatttttttcctctcacttaggaacaatatga
Sequence Length
444
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,309 Da
NCBI Official Full Name
Homo sapiens PWP1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
PWP1 homolog, endonuclein
NCBI Official Symbol
PWP1
NCBI Official Synonym Symbols
IEF-SSP-9502
NCBI Protein Information
periodic tryptophan protein 1 homolog
UniProt Protein Name
Periodic tryptophan protein 1 homolog
UniProt Gene Name
PWP1
UniProt Entry Name
PWP1_HUMAN

NCBI Description

The protein encoded by this gene contains several WD-40 repeats and is found mostly in the nucleus. The expression and localization of this protein are cell cycle dependent. Expression of this gene is upregulated in pancreatic adenocarcinoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]

Uniprot Description

PWP1: May play an important role in cell growth and/or transcription. Belongs to the WD repeat PWP1 family.

Protein type: Histone-binding

Chromosomal Location of Human Ortholog: 12q23.3

Cellular Component: Golgi apparatus; nucleolus; nucleus

Biological Process: transcription, DNA-dependent

Research Articles on PWP1

Similar Products

Product Notes

The PWP1 pwp1 (Catalog #AAA1268362) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccgca gccgccaggt gacgtgcgtg gcctgggtcc gctgcggcgt ggccaaagag acaccagaca aggtagagct gagtaaagaa gaagtaaaac gcctcattgc tgaggcaaag gagaaattgc aagaagaagg tggtggcagt gatgaagagg agacaggcag tccttcagaa gatggcatgc agagtgcacg cacccaggca cgcccaagag agcccctgga ggatggtgac ccagaggatg acaggacgct tgatgatgat gagctggctg agtacgactt agataaatat gatgaggaag gtgacccaga tgctgagact cttggtgaat ctctcttggg tcttacggtc tacgggagta atgatcaaga tccttacgtt actctgaaag atacatcaat gacatttttt tcctctcact taggaacaat atga. It is sometimes possible for the material contained within the vial of "PWP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.