Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPRO cdna clone

PTPRO cDNA Clone

Gene Names
PTPRO; NPHS6; PTPU2; GLEPP1; PTP-OC; PTP-U2; PTPROT; R-PTP-O
Synonyms
PTPRO; PTPRO cDNA Clone; PTPRO cdna clone
Ordering
For Research Use Only!
Sequence
atggggcacctgcccacggggatacacggcgcccgccgcctcctgcctctgctctggctctttgtgctgttcaagaatgctacagctttccatgtaactgtccaagatgataataacatcgttgtctcattagaagcttcagacgtcatcagtccagcatctgtgtatgttgtgaagataactggtgaatccaaaaattatttcttcgaatttgaggaattcaacagcactttgcctcctcctgttattttcaaggccagttatcatggcctttattatataatcactctggtagtggtaaatggaaatgtggtgaccaagccatccagatcaatcactgtgttaacaaaacctctacctgtaaccagtgtttccatatatgactataaaccttctcctgaaacaggagtcctgtttgaaatacattatccagaaaaatataacgttttcacaagagtgaacattagctactgggaaggtaaagacttccggacaatgctatataaagatttctttaagggaaaaacagtatttaatcactggctgccaggaatgtgttatagtaatatcacctttcagctggtatctgaggcaacttttaataaaagtacccttgttgagtacagtggtgtcagtcacgaacccaaacagcacagaactgccccttatccacctcaaaatatttccgttcgtatcgtaaacttgaacaaaaacaactgggaagaacagagtggcaatttcccagaagaatccttcatgagatcacaagatacaataggaaaagaaaaactcttccattttacagaagaaacccctgaaattccctcgggcaacatttcttccggttggcctgattttaatagcagtgactatgaaactacgtctcagccatattggtgggacagtgcatctgcagctcctgaaagtgaagatgaatttgtcagcgtacttcccatggaatacgaaaataacagtacactcagtgagacagagaagtcaacatcaggctctttctcctttttccctgtgcaaatgatattgacctggttaccacccaaaccacccactgcttttgatgggttccatatccatattgaacgagaagagaactttactgaatatttgatggtggatgaagaagcacatgaatttgttgcagaactgaaggaacctgggaaatataagttatctgtgacaacctttagttcctcaggatcttgtgaaactcgaaaaagtcagtcagcaaaatcactcagcttttatatcagtccttcaggagagtggattgaagaactgaccgagaagccgcagcacgtgagtgtccacgttttaagctcaaccactgccttgatgtcctggacatcttcccaagagaactacaacagcaccattgtgtctgtggtgtcgctgacctgccagaaacaaaaggagagccagaggcttgaaaagcagtactgcactcaggtgaactcaagcaaacctattattgaaaatctggttcctggtgcccagtaccaggttgtaatatacctaaggaaaggccctttgattggaccaccttcagatcctgtgacatttgctattgttcccacaggaataaaggatttaatgctctatcctttgggtcctacggccgtggttctgagctggaccagaccttatttaggcgtgttcagaaaatacgtggttgaaatgttttatttcaaccctgctacaatgacatcagagtggaccacctactatgaaatagcagcaactgtttccttaactgcatccgtgagaatagctaatctgctgccagcatggtactacaacttccgggttaccatggtgacgtggggagatccagaattgagctgctgtgacagctctaccatcagcttcataacagccccagtggctccggaaatcacttctgtggaatatttcaacagtctgttatatatcagttggacatatggggatgatacaacggacttgtcccattctagaatgcttcactggatggtggttgcagaaggaaaaaagaaaattaaaaagagtgtaacacgcaatgtcatgactgcaattctcagcttgcctccaggcgacatctataacctctcagtaactgcttgtactgaaagaggaagtaatacctccatgctccgccttgtcaagctagaaccagctccacccaaatcactcttcgcagtgaacaaaacccagacttcagtgactttgctgtgggtggaagagggagtagctgatttctttgaagttttctgtcaacaagttggctccagtcagaaaaccaaacttcaggaaccagttgctgtttcttcccatgtcgtgaccatctccagccttcttcctgccactgcctacaattgtagtgtcaccagctttagccatgacagccccagtgtccctacgttcatagccgtctcaacaatggttacagagatgaatcccaatgtggtagtgatctccgtgctggccatccttagcacacttttaattggactgttgcttgttaccctcattattcttaggaaaaagcatctgcagatggctagggagtgtggagctggtacatttgtcaattttgcatccttagagagggatggaaagcttccatacaactggcgtaggagtatatttgctttcttaaccctgctaccctcatgtctttggactgattatcttttggcattttatattaatccttggagtaaaaatggtttaaagaagaggaaactgacaaacccggttcaactggatgactttgatgcctatattaaggatatggccaaagactctgactataaattttctcttcagtttgaggagttgaaattgattggactggatatcccacactttgctgcagatcttccactgaatcgatgtaaaaaccgttacacaaacatcctaccatatgacttcagccgtgtgagattagtctccatgaatgaagaggaaggtgcagactacatcaatgccaactatattcctggatacaactcaccccaggagtatattgccacccaggggccactgcctgaaaccagaaatgacttctggaagatggtcctgcaacaaaagtctcagattattgtcatgctcactcagtgtaatgagaaaaggagggtgaaatgtgaccattactggccattcacggaagaacctatagcctatggagacatcactgtggagatgatttcagaggaagagcaggacgactgggcctgtagacacttccggatcaactatgctgacgagatgcaggatgtgatgcattttaactacactgcatggcctgatcatggtgtgcccacagcaaatgctgcagaaagtatcctgcagtttgtacacatggtccgacagcaagctaccaagagcaaaggtcccatgatcattcactgcagtgctggcgtgggacggacaggaacattcattgccctggacaggctcttgcagcacattcgggatcatgagtttgttgacatcttagggctggtgtcagaaatgaggtcataccggatgtctatggtacagacagaggagcagtacatttttatccatcagtgtgtgcaactgatgtggatgaagaagaagcagcagttctgcatcagtgatgtcatatacgagaatgttagcaagtcctag
Sequence Length
3651
Vector
pUC
Clone Sequence Report
Provided with product shipment
Related Product Information for PTPRO cdna clone
Homo sapiens protein tyrosine phosphatase, receptor type, O, mRNA (cDNA clone MGC:161479 IMAGE:8991917), complete cds.

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
138,344 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, receptor type, O, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, receptor type, O
NCBI Official Symbol
PTPRO
NCBI Official Synonym Symbols
NPHS6; PTPU2; GLEPP1; PTP-OC; PTP-U2; PTPROT; R-PTP-O
NCBI Protein Information
receptor-type tyrosine-protein phosphatase O; PTP phi; PTPase U2; phosphotyrosine phosphatase U2; glomerular epithelial protein 1; protein tyrosine phosphatase PTP-U2; osteoclastic transmembrane protein-tyrosine phosphatase
UniProt Protein Name
Receptor-type tyrosine-protein phosphatase O
UniProt Gene Name
PTPRO
UniProt Synonym Gene Names
GLEPP1; PTPU2; R-PTP-O; PTP-U2; PTPase U2
UniProt Entry Name
PTPRO_HUMAN

NCBI Description

This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]

Uniprot Description

PTPRO: Possesses tyrosine phosphatase activity. Plays a role in regulating the glomerular pressure/filtration rate relationship through an effect on podocyte structure and function. Defects in PTPRO are the cause of nephrotic syndrome type 6 (NPHS6). NPHS6 is a renal disease characterized clinically by proteinuria, hypoalbuminemia, hyperlipidemia and edema. Kidney biopsies show non-specific histologic changes such as focal segmental glomerulosclerosis and diffuse mesangial proliferation. Some affected individuals have an inherited steroid-resistant form and progress to end-stage renal failure. Belongs to the protein-tyrosine phosphatase family. Receptor class 3 subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor protein phosphatase, tyrosine; Motility/polarity/chemotaxis; EC 3.1.3.48; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.3-p13.2|12p13-p12

Cellular Component: neuron projection; growth cone; lamellipodium; integral to plasma membrane; axon; apical plasma membrane; integral to membrane; plasma membrane; dendritic spine; lateral plasma membrane

Molecular Function: Wnt-protein binding; protein binding; protein homodimerization activity; phosphoric monoester hydrolase activity; transmembrane receptor protein tyrosine phosphatase activity; protein tyrosine phosphatase activity

Biological Process: lamellipodium biogenesis; axon guidance; monocyte chemotaxis; regulation of glomerular filtration; negative regulation of glomerular filtration; cell morphogenesis; protein amino acid dephosphorylation; glomerulus development

Disease: Nephrotic Syndrome, Type 6

Research Articles on PTPRO

Similar Products

Product Notes

The PTPRO ptpro (Catalog #AAA1269792) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcacc tgcccacggg gatacacggc gcccgccgcc tcctgcctct gctctggctc tttgtgctgt tcaagaatgc tacagctttc catgtaactg tccaagatga taataacatc gttgtctcat tagaagcttc agacgtcatc agtccagcat ctgtgtatgt tgtgaagata actggtgaat ccaaaaatta tttcttcgaa tttgaggaat tcaacagcac tttgcctcct cctgttattt tcaaggccag ttatcatggc ctttattata taatcactct ggtagtggta aatggaaatg tggtgaccaa gccatccaga tcaatcactg tgttaacaaa acctctacct gtaaccagtg tttccatata tgactataaa ccttctcctg aaacaggagt cctgtttgaa atacattatc cagaaaaata taacgttttc acaagagtga acattagcta ctgggaaggt aaagacttcc ggacaatgct atataaagat ttctttaagg gaaaaacagt atttaatcac tggctgccag gaatgtgtta tagtaatatc acctttcagc tggtatctga ggcaactttt aataaaagta cccttgttga gtacagtggt gtcagtcacg aacccaaaca gcacagaact gccccttatc cacctcaaaa tatttccgtt cgtatcgtaa acttgaacaa aaacaactgg gaagaacaga gtggcaattt cccagaagaa tccttcatga gatcacaaga tacaatagga aaagaaaaac tcttccattt tacagaagaa acccctgaaa ttccctcggg caacatttct tccggttggc ctgattttaa tagcagtgac tatgaaacta cgtctcagcc atattggtgg gacagtgcat ctgcagctcc tgaaagtgaa gatgaatttg tcagcgtact tcccatggaa tacgaaaata acagtacact cagtgagaca gagaagtcaa catcaggctc tttctccttt ttccctgtgc aaatgatatt gacctggtta ccacccaaac cacccactgc ttttgatggg ttccatatcc atattgaacg agaagagaac tttactgaat atttgatggt ggatgaagaa gcacatgaat ttgttgcaga actgaaggaa cctgggaaat ataagttatc tgtgacaacc tttagttcct caggatcttg tgaaactcga aaaagtcagt cagcaaaatc actcagcttt tatatcagtc cttcaggaga gtggattgaa gaactgaccg agaagccgca gcacgtgagt gtccacgttt taagctcaac cactgccttg atgtcctgga catcttccca agagaactac aacagcacca ttgtgtctgt ggtgtcgctg acctgccaga aacaaaagga gagccagagg cttgaaaagc agtactgcac tcaggtgaac tcaagcaaac ctattattga aaatctggtt cctggtgccc agtaccaggt tgtaatatac ctaaggaaag gccctttgat tggaccacct tcagatcctg tgacatttgc tattgttccc acaggaataa aggatttaat gctctatcct ttgggtccta cggccgtggt tctgagctgg accagacctt atttaggcgt gttcagaaaa tacgtggttg aaatgtttta tttcaaccct gctacaatga catcagagtg gaccacctac tatgaaatag cagcaactgt ttccttaact gcatccgtga gaatagctaa tctgctgcca gcatggtact acaacttccg ggttaccatg gtgacgtggg gagatccaga attgagctgc tgtgacagct ctaccatcag cttcataaca gccccagtgg ctccggaaat cacttctgtg gaatatttca acagtctgtt atatatcagt tggacatatg gggatgatac aacggacttg tcccattcta gaatgcttca ctggatggtg gttgcagaag gaaaaaagaa aattaaaaag agtgtaacac gcaatgtcat gactgcaatt ctcagcttgc ctccaggcga catctataac ctctcagtaa ctgcttgtac tgaaagagga agtaatacct ccatgctccg ccttgtcaag ctagaaccag ctccacccaa atcactcttc gcagtgaaca aaacccagac ttcagtgact ttgctgtggg tggaagaggg agtagctgat ttctttgaag ttttctgtca acaagttggc tccagtcaga aaaccaaact tcaggaacca gttgctgttt cttcccatgt cgtgaccatc tccagccttc ttcctgccac tgcctacaat tgtagtgtca ccagctttag ccatgacagc cccagtgtcc ctacgttcat agccgtctca acaatggtta cagagatgaa tcccaatgtg gtagtgatct ccgtgctggc catccttagc acacttttaa ttggactgtt gcttgttacc ctcattattc ttaggaaaaa gcatctgcag atggctaggg agtgtggagc tggtacattt gtcaattttg catccttaga gagggatgga aagcttccat acaactggcg taggagtata tttgctttct taaccctgct accctcatgt ctttggactg attatctttt ggcattttat attaatcctt ggagtaaaaa tggtttaaag aagaggaaac tgacaaaccc ggttcaactg gatgactttg atgcctatat taaggatatg gccaaagact ctgactataa attttctctt cagtttgagg agttgaaatt gattggactg gatatcccac actttgctgc agatcttcca ctgaatcgat gtaaaaaccg ttacacaaac atcctaccat atgacttcag ccgtgtgaga ttagtctcca tgaatgaaga ggaaggtgca gactacatca atgccaacta tattcctgga tacaactcac cccaggagta tattgccacc caggggccac tgcctgaaac cagaaatgac ttctggaaga tggtcctgca acaaaagtct cagattattg tcatgctcac tcagtgtaat gagaaaagga gggtgaaatg tgaccattac tggccattca cggaagaacc tatagcctat ggagacatca ctgtggagat gatttcagag gaagagcagg acgactgggc ctgtagacac ttccggatca actatgctga cgagatgcag gatgtgatgc attttaacta cactgcatgg cctgatcatg gtgtgcccac agcaaatgct gcagaaagta tcctgcagtt tgtacacatg gtccgacagc aagctaccaa gagcaaaggt cccatgatca ttcactgcag tgctggcgtg ggacggacag gaacattcat tgccctggac aggctcttgc agcacattcg ggatcatgag tttgttgaca tcttagggct ggtgtcagaa atgaggtcat accggatgtc tatggtacag acagaggagc agtacatttt tatccatcag tgtgtgcaac tgatgtggat gaagaagaag cagcagttct gcatcagtga tgtcatatac gagaatgtta gcaagtccta g. It is sometimes possible for the material contained within the vial of "PTPRO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.