Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPMT1 cdna clone

PTPMT1 cDNA Clone

Gene Names
PTPMT1; MOSP; PLIP; DUSP23; PNAS-129
Synonyms
PTPMT1; PTPMT1 cDNA Clone; PTPMT1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccaccgcgctgctggaggccggcctggcgcgggtgctcttctacccgacgctgctctacaccctgttccgcgggaaggtgccgggtcgggcgcaccgggactggtaccaccgcatcgaccccaccgtgctgctgggcgcgctgccgttgcggagcttgacgcgccagctggtacaggacgagaacgtgcgcggggtgatcaccatgaacgaggagtacgagacgaggttcctgtgcaactcttcacaggagtggaagagactaggagtcgagcagctgcggctcagcacagtagacatgactgggatccccaccttggacaacctccagaagggagtccaatttgctctcaagtaccagtcgctgggccagtgtgtttacgtgcattgtaaggctgggcgctccaggagtgccactatggtggcagcatacctgattcaggtgcacaaatggagtccagaggaggctgtaagagccatcgccaagatccggtcatacatccacatcaggcctggccagctggatgttcttaaagagttccacaagcagattactgcacgggcaacaaaggatgggacttttgtcatttcaaagacatga
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,459 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase, mitochondrial 1, mRNA
NCBI Official Synonym Full Names
protein tyrosine phosphatase, mitochondrial 1
NCBI Official Symbol
PTPMT1
NCBI Official Synonym Symbols
MOSP; PLIP; DUSP23; PNAS-129
NCBI Protein Information
phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1
UniProt Protein Name
Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1
UniProt Gene Name
PTPMT1
UniProt Synonym Gene Names
MOSP; PLIP
UniProt Entry Name
PTPM1_HUMAN

Uniprot Description

PTPMT1: Lipid phosphatase which dephosphorylates phosphatidylglycerophosphate (PGP) to phosphatidylglycerol (PG). PGP is an essential intermediate in the biosynthetic pathway of cardiolipin, a mitochondrial-specific phospholipid regulating the membrane integrity and activities of the organelle. Has also been shown to display phosphatase activity toward phosphoprotein substrates, specifically mediates dephosphorylation of mitochondrial proteins, thereby playing an essential role in ATP production. Has probably a preference for proteins phosphorylated on Ser and/or Thr residues compared to proteins phosphorylated on Tyr residues. Probably involved in regulation of insulin secretion in pancreatic beta cells. Belongs to the protein-tyrosine phosphatase family. Non-receptor class dual specificity subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.3.16; Mitochondrial; EC 3.1.3.48; Phosphatase, lipid; Protein phosphatase, dual-specificity; EC 3.1.3.27

Chromosomal Location of Human Ortholog: 11p11.2

Cellular Component: mitochondrion; nucleus

Molecular Function: phosphatidylglycerophosphatase activity; phosphoinositide 5-phosphatase activity; protein binding

Biological Process: cardiolipin biosynthetic process

Research Articles on PTPMT1

Similar Products

Product Notes

The PTPMT1 ptpmt1 (Catalog #AAA1269269) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcca ccgcgctgct ggaggccggc ctggcgcggg tgctcttcta cccgacgctg ctctacaccc tgttccgcgg gaaggtgccg ggtcgggcgc accgggactg gtaccaccgc atcgacccca ccgtgctgct gggcgcgctg ccgttgcgga gcttgacgcg ccagctggta caggacgaga acgtgcgcgg ggtgatcacc atgaacgagg agtacgagac gaggttcctg tgcaactctt cacaggagtg gaagagacta ggagtcgagc agctgcggct cagcacagta gacatgactg ggatccccac cttggacaac ctccagaagg gagtccaatt tgctctcaag taccagtcgc tgggccagtg tgtttacgtg cattgtaagg ctgggcgctc caggagtgcc actatggtgg cagcatacct gattcaggtg cacaaatgga gtccagagga ggctgtaaga gccatcgcca agatccggtc atacatccac atcaggcctg gccagctgga tgttcttaaa gagttccaca agcagattac tgcacgggca acaaaggatg ggacttttgt catttcaaag acatga. It is sometimes possible for the material contained within the vial of "PTPMT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.