Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTPLB cdna clone

PTPLB cDNA Clone

Gene Names
HACD2; PTPLB
Synonyms
PTPLB; PTPLB cDNA Clone; PTPLB cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcagtggcggcgactgcagcagcgaaggggaatgggggcggcggtggcagggccggggccggggacgccagcggcacgcggaagaagaagggcccggggcccctggccacggcgtacctggtcatctacaatgtggtgatgacagccgggtggctggttatagcggttggtctggtccgagcatacctggctaagggtagctaccatagcctttattattcaattgaaaagcctttgaaattctttcaaactggagccttattggagattttacattgtgctataggaattgttccatcttctgttgtcctgacttctttccaggtgatgtcaagagtttttctaatatgggcagtaacacatagcgtcaaagaggtacagagtgaagacagtgtcctcctgtttgttattgcatggacgatcacggaaatcatccgttactccttttatacattcagtctattaaaccatctgccttacctcatcaaatgggccaggtacacacttttcattgtgctgtacccaatgggagtgtcaggagaactgctcacaatatatgcagctctgccctttgtcagacaagctggcctatattccatcagtttacccaacaaatacaatttctcttttgactactatgcattcctgattctaataatgatctcctacattccaatttttccccagttatacttccacatgatacaccagagaagaaagatcctttctcatactgaagaacacaagaaatttgaatag
Sequence Length
765
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,368 Da
NCBI Official Full Name
Homo sapiens protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b, mRNA
NCBI Official Synonym Full Names
3-hydroxyacyl-CoA dehydratase 2
NCBI Official Symbol
HACD2
NCBI Official Synonym Symbols
PTPLB
NCBI Protein Information
very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 2
UniProt Protein Name
Very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 2
UniProt Gene Name
HACD2
UniProt Synonym Gene Names
HACD2
UniProt Entry Name
HACD2_HUMAN

NCBI Description

The protein encoded by this gene can catalyze the third step (dehydration) in the conversion of long chain fatty acids to very long chain fatty acids. The encoded protein localizes to the endoplasmic reticulum membrane. [provided by RefSeq, Jul 2016]

Uniprot Description

PTPLB: Responsible for the dehydration step in very long-chain fatty acids (VLCFAs) synthesis. Belongs to the very long-chain fatty acids dehydratase HACD family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Lipid Metabolism - unsaturated fatty acid biosynthesis; EC 4.2.1.134

Chromosomal Location of Human Ortholog: 3q21.1

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane

Molecular Function: 3-hydroxyacyl-CoA dehydratase activity; enzyme binding; protein binding; protein tyrosine phosphatase activity

Biological Process: fatty acid elongation; sphingolipid biosynthetic process; very-long-chain fatty acid biosynthetic process

Research Articles on PTPLB

Similar Products

Product Notes

The PTPLB hacd2 (Catalog #AAA1272026) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcag tggcggcgac tgcagcagcg aaggggaatg ggggcggcgg tggcagggcc ggggccgggg acgccagcgg cacgcggaag aagaagggcc cggggcccct ggccacggcg tacctggtca tctacaatgt ggtgatgaca gccgggtggc tggttatagc ggttggtctg gtccgagcat acctggctaa gggtagctac catagccttt attattcaat tgaaaagcct ttgaaattct ttcaaactgg agccttattg gagattttac attgtgctat aggaattgtt ccatcttctg ttgtcctgac ttctttccag gtgatgtcaa gagtttttct aatatgggca gtaacacata gcgtcaaaga ggtacagagt gaagacagtg tcctcctgtt tgttattgca tggacgatca cggaaatcat ccgttactcc ttttatacat tcagtctatt aaaccatctg ccttacctca tcaaatgggc caggtacaca cttttcattg tgctgtaccc aatgggagtg tcaggagaac tgctcacaat atatgcagct ctgccctttg tcagacaagc tggcctatat tccatcagtt tacccaacaa atacaatttc tcttttgact actatgcatt cctgattcta ataatgatct cctacattcc aatttttccc cagttatact tccacatgat acaccagaga agaaagatcc tttctcatac tgaagaacac aagaaatttg aatag. It is sometimes possible for the material contained within the vial of "PTPLB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.