Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTK2B cdna clone

PTK2B cDNA Clone

Gene Names
PTK2B; PKB; PTK; CAKB; FAK2; PYK2; CADTK; FADK2; RAFTK
Synonyms
PTK2B; PTK2B cDNA Clone; PTK2B cdna clone
Ordering
For Research Use Only!
Sequence
atgtctggggtgtccgagcccctgagtcgagtaaagttgggcacgttacgccggcctgaaggccctgcagagcccatggtggtggtaccagtagatgtggaaaaggaggacgtgcgtatcctcaaggtctgcttctatagcaacagcttcaatcctgggaaaaacttcaaactggtcaaatgcactgtccagacggagatccgggagatcatcacctccatcctgctgagcgggcggatcgggcccaacatccggttggctgagtgctatgggctgaggctgaagcacatgaagtccgatgagatccactggctgcacccacagatgacagtgggtgaggtgcaggacaagtatgagtgtctgcacgtggaagccgagtggaggtatgaccttcaaatccgctacttgccagaagacttcatggagagcctgaaggaggacaggaccacgctgctctatttttaccaacagctccggaacgactacatgcagcgctacgccagcaaggtcagcgagggcatggccctgcagctgggctgcctggagctcaggcggttcttcaaggatatgccccacaatgcacttgacaagaagtccaacttcgagctcctagaaaaggaagtggggctggacttgtttttcccaaagcagatgcaggagaacttaaagcccaaacagttccggaagatgatccagcagaccttccagcagtacgcctcgctcagggaggaggagtgcgtcatgaagttcttcaacactctcgccggcttcgccaacatcgaccaggagacctaccgctgtgaactcattcaaggatggaacattactgtggacctggtcattggccctaaagggatccgccagctgactagtcaggacgcaaagcccacctgcctggccgagttcaagcagatcaggtccatcaggtgcctcccgctggaggagggccaggcagtacttcagctgggcattgaaggtgccccccaggccttgtccatcaaaacctcatccctagcagaggctgagaacatggctgacctcatagacggctactgccggctgcagggtgagcaccaaggctctctcatcatccatcctaggaaagatggtgagaagcggaacagcctgccccagatccccatgctaaacctggaggcccggcggtcccacctctcagagagctgcagcatagagtcagacatctacgcagagattcccgacgaaaccctgcgaaggcccggaggtccacagtatggcattgcccgtgaagatgtggtcctgaatcgtattcttggggaaggcttttttggggaggtctatgaaggtgtctacacaaatcataaaggggagaaaatcaatgtagctgtcaagacctgcaagaaagactgcactctggacaacaaggagaagttcatgagcgaggcagtgatcatgaagaacctcgaccacccgcacatcgtgaagctgatcggcatcattgaagaggagcccacctggatcatcatggaattgtatccctatggggagctgggccactacctggagcggaacaagaactccctgaaggtgctcaccctcgtgctgtactcactgcagatatgcaaagccatggcctacctggagagcatcaactgcgtgcacagggacattgctgtccggaacatcctggtggcctcccctgagtgtgtgaagctgggggactttggtctttcccggtacattgaggacgaggactattacaaagcctctgtgactcgtctccccatcaaatggatgtccccagagtccattaacttccgacgcttcacgacagccagtgacgtctggatgttcgccgtgtgcatgtgggagatcctgagctttgggaagcagcccttcttctggctggagaacaaggatgtcatcggggtgctggagaaaggagaccggctgcccaagcctgatctctgtccaccggtcctttataccctcatgacccgctgctgggactacgaccccagtgaccggccccgcttcaccgagctggtgtgcagcctcagtgacgtttatcagatggagaaggacattgccatggagcaagagaggaatgctcgctaccgaacccccaaaatcttggagcccacagccttccaggaacccccacccaagcccagccgacctaagtacagaccccctccgcaaaccaacctcctggctccaaagctgcagttccaggttcctgagggtctgtgtgccagctctcctacgctcaccagccctatggagtatccatctcccgttaactcactgcacaccccacctctccaccggcacaatgtcttcaaacgccacagcatgcgggaggaggacttcatccaacccagcagccgagaagaggcccagcagctgtgggaggctgaaaaggtcaaaatgcggcaaatcctggacaaacagcagaagcagatggtggaggactaccagtggctcaggcaggaggagaagtccctggaccccatggtttatatgaatgataagtccccattgacgccagagaaggaggtcggctacctggagttcacagggcccccacagaagcccccgaggctgggcgcacagtccatccagcccacagctaacctggaccggaccgatgacctggtgtacctcaatgtcatggagctggtgcgggccgtgctggagctcaagaatgagctctgtcagctgccccccgagggctacgtggtggtggtgaagaatgtggggctgaccctgcggaagctcatcgggagcgtggatgatctcctgccttccttgccgtcatcttcacggacagagatcgagggcacccagaaactgctcaacaaagacctggcagagctcatcaacaagatgcggctggcgcagcagaacgccgtgacctccctgagtgaggagtgcaagaggcagatgctgacggcttcacacaccctggctgtggacgccaagaacctgctcgacgctgtggaccaggccaaggttctggccaatctggcccacccacctgcagagtga
Sequence Length
3030
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
111,183 Da
NCBI Official Full Name
Homo sapiens PTK2B protein tyrosine kinase 2 beta, mRNA
NCBI Official Synonym Full Names
protein tyrosine kinase 2 beta
NCBI Official Symbol
PTK2B
NCBI Official Synonym Symbols
PKB; PTK; CAKB; FAK2; PYK2; CADTK; FADK2; RAFTK
NCBI Protein Information
protein-tyrosine kinase 2-beta
UniProt Protein Name
Protein-tyrosine kinase 2-beta
Protein Family
UniProt Gene Name
PTK2B
UniProt Synonym Gene Names
FAK2; PYK2; RAFTK; CADTK; CAK-beta; CAKB; FADK 2; RAFTK
UniProt Entry Name
FAK2_HUMAN

NCBI Description

This gene encodes a cytoplasmic protein tyrosine kinase which is involved in calcium-induced regulation of ion channels and activation of the map kinase signaling pathway. The encoded protein may represent an important signaling intermediate between neuropeptide-activated receptors or neurotransmitters that increase calcium flux and the downstream signals that regulate neuronal activity. The encoded protein undergoes rapid tyrosine phosphorylation and activation in response to increases in the intracellular calcium concentration, nicotinic acetylcholine receptor activation, membrane depolarization, or protein kinase C activation. This protein has been shown to bind CRK-associated substrate, nephrocystin, GTPase regulator associated with FAK, and the SH2 domain of GRB2. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

Pyk2: a nonreceptor tyrosine kinase of the Fak family. Predominantly expressed in the cells derived from hematopoietic lineages and in the central nervous system. Pyk2 is one of the signaling mediators for G-protein-coupled receptors. Involved in calcium induced regulation of ion channel and activation of the map kinase signaling pathway. Interacts with the SH2 domain of Grb2. May phosphorylate the voltage-gated potassium channel protein Kv1.2. Its activation is highly correlated with the stimulation of c-Jun N-terminal kinase activity. It plays an important role in cell motility such as spreading and migration. Two alternatively spliced isoforms have been described.

Protein type: Kinase, protein; Nuclear receptor co-regulator; EC 2.7.10.2; Protein kinase, tyrosine (non-receptor); Protein kinase, TK; TK group; Fak family

Chromosomal Location of Human Ortholog: 8p21.1

Cellular Component: cell soma; cytoplasm; cytosol; dendrite; extrinsic to internal side of plasma membrane; focal adhesion; growth cone; lamellipodium; N-methyl-D-aspartate selective glutamate receptor complex; nucleoplasm; nucleus; perinuclear region of cytoplasm; postsynaptic density

Molecular Function: calmodulin-dependent protein kinase activity; N-methyl-D-aspartate selective glutamate receptor activity; non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding

Biological Process: activation of JAK protein; angiogenesis; apoptosis; bone resorption; cell surface receptor linked signal transduction; cellular defense response; epidermal growth factor receptor signaling pathway; innate immune response; integrin-mediated signaling pathway; ionotropic glutamate receptor signaling pathway; marginal zone B cell differentiation; negative regulation of apoptosis; negative regulation of bone mineralization; negative regulation of cell proliferation; negative regulation of myeloid cell differentiation; negative regulation of neuron apoptosis; negative regulation of potassium ion transport; peptidyl-tyrosine phosphorylation; positive regulation of actin filament polymerization; positive regulation of cell migration; positive regulation of cell proliferation; positive regulation of cell-matrix adhesion; positive regulation of JNK cascade; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of phosphoinositide 3-kinase activity; positive regulation of protein kinase activity; positive regulation of synaptic transmission, glutamatergic; protein amino acid autophosphorylation; protein amino acid phosphorylation; protein complex assembly; regulation of cell adhesion; regulation of cell shape; regulation of inositol trisphosphate biosynthetic process; regulation of release of sequestered calcium ion into cytosol; response to stress; signal transduction; sprouting angiogenesis; tumor necrosis factor-mediated signaling pathway; vascular endothelial growth factor receptor signaling pathway

Research Articles on PTK2B

Similar Products

Product Notes

The PTK2B ptk2b (Catalog #AAA1267704) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgggg tgtccgagcc cctgagtcga gtaaagttgg gcacgttacg ccggcctgaa ggccctgcag agcccatggt ggtggtacca gtagatgtgg aaaaggagga cgtgcgtatc ctcaaggtct gcttctatag caacagcttc aatcctggga aaaacttcaa actggtcaaa tgcactgtcc agacggagat ccgggagatc atcacctcca tcctgctgag cgggcggatc gggcccaaca tccggttggc tgagtgctat gggctgaggc tgaagcacat gaagtccgat gagatccact ggctgcaccc acagatgaca gtgggtgagg tgcaggacaa gtatgagtgt ctgcacgtgg aagccgagtg gaggtatgac cttcaaatcc gctacttgcc agaagacttc atggagagcc tgaaggagga caggaccacg ctgctctatt tttaccaaca gctccggaac gactacatgc agcgctacgc cagcaaggtc agcgagggca tggccctgca gctgggctgc ctggagctca ggcggttctt caaggatatg ccccacaatg cacttgacaa gaagtccaac ttcgagctcc tagaaaagga agtggggctg gacttgtttt tcccaaagca gatgcaggag aacttaaagc ccaaacagtt ccggaagatg atccagcaga ccttccagca gtacgcctcg ctcagggagg aggagtgcgt catgaagttc ttcaacactc tcgccggctt cgccaacatc gaccaggaga cctaccgctg tgaactcatt caaggatgga acattactgt ggacctggtc attggcccta aagggatccg ccagctgact agtcaggacg caaagcccac ctgcctggcc gagttcaagc agatcaggtc catcaggtgc ctcccgctgg aggagggcca ggcagtactt cagctgggca ttgaaggtgc cccccaggcc ttgtccatca aaacctcatc cctagcagag gctgagaaca tggctgacct catagacggc tactgccggc tgcagggtga gcaccaaggc tctctcatca tccatcctag gaaagatggt gagaagcgga acagcctgcc ccagatcccc atgctaaacc tggaggcccg gcggtcccac ctctcagaga gctgcagcat agagtcagac atctacgcag agattcccga cgaaaccctg cgaaggcccg gaggtccaca gtatggcatt gcccgtgaag atgtggtcct gaatcgtatt cttggggaag gcttttttgg ggaggtctat gaaggtgtct acacaaatca taaaggggag aaaatcaatg tagctgtcaa gacctgcaag aaagactgca ctctggacaa caaggagaag ttcatgagcg aggcagtgat catgaagaac ctcgaccacc cgcacatcgt gaagctgatc ggcatcattg aagaggagcc cacctggatc atcatggaat tgtatcccta tggggagctg ggccactacc tggagcggaa caagaactcc ctgaaggtgc tcaccctcgt gctgtactca ctgcagatat gcaaagccat ggcctacctg gagagcatca actgcgtgca cagggacatt gctgtccgga acatcctggt ggcctcccct gagtgtgtga agctggggga ctttggtctt tcccggtaca ttgaggacga ggactattac aaagcctctg tgactcgtct ccccatcaaa tggatgtccc cagagtccat taacttccga cgcttcacga cagccagtga cgtctggatg ttcgccgtgt gcatgtggga gatcctgagc tttgggaagc agcccttctt ctggctggag aacaaggatg tcatcggggt gctggagaaa ggagaccggc tgcccaagcc tgatctctgt ccaccggtcc tttataccct catgacccgc tgctgggact acgaccccag tgaccggccc cgcttcaccg agctggtgtg cagcctcagt gacgtttatc agatggagaa ggacattgcc atggagcaag agaggaatgc tcgctaccga acccccaaaa tcttggagcc cacagccttc caggaacccc cacccaagcc cagccgacct aagtacagac cccctccgca aaccaacctc ctggctccaa agctgcagtt ccaggttcct gagggtctgt gtgccagctc tcctacgctc accagcccta tggagtatcc atctcccgtt aactcactgc acaccccacc tctccaccgg cacaatgtct tcaaacgcca cagcatgcgg gaggaggact tcatccaacc cagcagccga gaagaggccc agcagctgtg ggaggctgaa aaggtcaaaa tgcggcaaat cctggacaaa cagcagaagc agatggtgga ggactaccag tggctcaggc aggaggagaa gtccctggac cccatggttt atatgaatga taagtcccca ttgacgccag agaaggaggt cggctacctg gagttcacag ggcccccaca gaagcccccg aggctgggcg cacagtccat ccagcccaca gctaacctgg accggaccga tgacctggtg tacctcaatg tcatggagct ggtgcgggcc gtgctggagc tcaagaatga gctctgtcag ctgccccccg agggctacgt ggtggtggtg aagaatgtgg ggctgaccct gcggaagctc atcgggagcg tggatgatct cctgccttcc ttgccgtcat cttcacggac agagatcgag ggcacccaga aactgctcaa caaagacctg gcagagctca tcaacaagat gcggctggcg cagcagaacg ccgtgacctc cctgagtgag gagtgcaaga ggcagatgct gacggcttca cacaccctgg ctgtggacgc caagaacctg ctcgacgctg tggaccaggc caaggttctg gccaatctgg cccacccacc tgcagagtga. It is sometimes possible for the material contained within the vial of "PTK2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.