Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PTH2R cdna clone

PTH2R cDNA Clone

Gene Names
PTH2R; PTHR2
Synonyms
PTH2R; PTH2R cDNA Clone; PTH2R cdna clone
Ordering
For Research Use Only!
Sequence
atggccgggctgggggcgtcgctccacgtctggggttggctaatgctcggcagctgcctcctggccagagcccagctggattctgatggcaccattactatagaggagcagattgtccttgtgctgaaagcgaaagtacaatgtgaactcaacatcacagctcaactccaggagggagaaggtaattgtttccctgaatgggatggactcatttgttggcccagaggaacagtggggaaaatatcggctgttccatgccctccttatatttatgacttcaaccataaaggagttgctttccgacactgtaaccccaatggaacatgggattttatgcacagcttaaataaaacatgggccaattattcagactgccttcgctttctgcagccagatatcagcataggaaagcaagaattctttgaacgcctctatgtaatgtataccgttggctactccatctcttttggttccttggctgtggctattctcatcattggttacttcagacgattgcattgcactaggaactatatccacatgcacttatttgtgtctttcatgctgagagctacaagcatctttgtcaaagacagagtagtccatgctcacataggagtaaaggagctggagtccctaataatgcaggatgacccacaaaattccattgaggcaacttctgtggacaaatcacaatatatcgggtgcaagattgctgttgtgatgtttatttacttcctggctacaaattattattggatcctggtggaaggtctctacctgcataatctcatctttgtggctttcttttcggacaccaaatacctgtggggcttcatcttgataggctgggggtttccagcagcatttgttgcagcatgggctgtggcacgagcaactctggctgatgcgaggtgctgggaacttagtgctggagacatcaagtggatttatcaagcaccgatcttagcagctattgggctgaattttattctgtttctgaatacggttagagttctagctaccaaaatctgggagaccaatgcagttgggcatgacacaaggaagcaatacaggaaactggccaaatcgacactggtcctggtcctagtctttggagtgcattacatcgtgttcgtatgcctgcctcactccttcactgggctcgggtgggagatccgcatgcactgtgagctcttcttcaactcctttcagggtttctttgtgtctatcatctactgctactgcaatggagaggttcaggcagaggtgaagaagatgtggagtcggtggaacctctccgtggactggaaaaggacaccgccatgtggcagccgcagatgcggctcagtgctcaccaccgtgacgcacagcaccagcagccagtcacaggtggcggccagcacacgcatggtgcttatctctggcaaagctgccaagatcgccagcagacagcctgacagccacatcactttacctggctatgtctggagtaactcagagcaggactgcctgccacactctttccacgaggagaccaaggaagatagtgggaggcagggagatgatattctaatggagaagccttccaggcctatggaatctaacccagacactgaaggatgccaaggagaaactgaggatgttctctga
Sequence Length
1653
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,236 Da
NCBI Official Full Name
Homo sapiens parathyroid hormone 2 receptor, mRNA
NCBI Official Synonym Full Names
parathyroid hormone 2 receptor
NCBI Official Symbol
PTH2R
NCBI Official Synonym Symbols
PTHR2
NCBI Protein Information
parathyroid hormone 2 receptor
UniProt Protein Name
Parathyroid hormone 2 receptor
UniProt Gene Name
PTH2R
UniProt Synonym Gene Names
PTHR2; PTH2 receptor
UniProt Entry Name
PTH2R_HUMAN

NCBI Description

The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Uniprot Description

PTH2R: This is a specific receptor for parathyroid hormone. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. PTH2R may be responsible for PTH effects in a number of physiological systems. It may play a significant role in pancreatic function. PTH2R presence in neurons indicates that it may function as a neurotransmitter receptor. Belongs to the G-protein coupled receptor 2 family.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 2

Chromosomal Location of Human Ortholog: 2q33

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: parathyroid hormone receptor activity; protein binding

Research Articles on PTH2R

Similar Products

Product Notes

The PTH2R pth2r (Catalog #AAA1274480) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgggc tgggggcgtc gctccacgtc tggggttggc taatgctcgg cagctgcctc ctggccagag cccagctgga ttctgatggc accattacta tagaggagca gattgtcctt gtgctgaaag cgaaagtaca atgtgaactc aacatcacag ctcaactcca ggagggagaa ggtaattgtt tccctgaatg ggatggactc atttgttggc ccagaggaac agtggggaaa atatcggctg ttccatgccc tccttatatt tatgacttca accataaagg agttgctttc cgacactgta accccaatgg aacatgggat tttatgcaca gcttaaataa aacatgggcc aattattcag actgccttcg ctttctgcag ccagatatca gcataggaaa gcaagaattc tttgaacgcc tctatgtaat gtataccgtt ggctactcca tctcttttgg ttccttggct gtggctattc tcatcattgg ttacttcaga cgattgcatt gcactaggaa ctatatccac atgcacttat ttgtgtcttt catgctgaga gctacaagca tctttgtcaa agacagagta gtccatgctc acataggagt aaaggagctg gagtccctaa taatgcagga tgacccacaa aattccattg aggcaacttc tgtggacaaa tcacaatata tcgggtgcaa gattgctgtt gtgatgttta tttacttcct ggctacaaat tattattgga tcctggtgga aggtctctac ctgcataatc tcatctttgt ggctttcttt tcggacacca aatacctgtg gggcttcatc ttgataggct gggggtttcc agcagcattt gttgcagcat gggctgtggc acgagcaact ctggctgatg cgaggtgctg ggaacttagt gctggagaca tcaagtggat ttatcaagca ccgatcttag cagctattgg gctgaatttt attctgtttc tgaatacggt tagagttcta gctaccaaaa tctgggagac caatgcagtt gggcatgaca caaggaagca atacaggaaa ctggccaaat cgacactggt cctggtccta gtctttggag tgcattacat cgtgttcgta tgcctgcctc actccttcac tgggctcggg tgggagatcc gcatgcactg tgagctcttc ttcaactcct ttcagggttt ctttgtgtct atcatctact gctactgcaa tggagaggtt caggcagagg tgaagaagat gtggagtcgg tggaacctct ccgtggactg gaaaaggaca ccgccatgtg gcagccgcag atgcggctca gtgctcacca ccgtgacgca cagcaccagc agccagtcac aggtggcggc cagcacacgc atggtgctta tctctggcaa agctgccaag atcgccagca gacagcctga cagccacatc actttacctg gctatgtctg gagtaactca gagcaggact gcctgccaca ctctttccac gaggagacca aggaagatag tgggaggcag ggagatgata ttctaatgga gaagccttcc aggcctatgg aatctaaccc agacactgaa ggatgccaag gagaaactga ggatgttctc tga. It is sometimes possible for the material contained within the vial of "PTH2R, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.