Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSME3 cdna clone

PSME3 cDNA Clone

Gene Names
PSME3; Ki; PA28G; HEL-S-283; PA28gamma; REG-GAMMA; PA28-gamma
Synonyms
PSME3; PSME3 cDNA Clone; PSME3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctcgttgctgaaggtggatcaggaagtgaagctcaaggttgattctttcagggagcggatcacaagtgaggcagaagacttggtggcaaattttttcccaaagaagttattagaacttgatagttttctgaaggaaccaatcttaaacatccatgacctaactcagatccactctgacatgaatctcccagtccctgaccccattcttctcaccaatagccatgatggactggatggtcccacttataagaagcgaaggttggatgagtgtgaagaagccttccaaggaaccaaggtgtttgtgatgcccaatgggatgctgaaaagcaaccagcagctggtggacattattgagaaagtgaaacctgagatccggctgttgattgagaaatgtaacacggtcaaaatgtgggtacagctcctgattcccaggatagaagatggaaacaactttggggtgtccattcaggaggaaacagttgcagagctaagaactgttgagagtgaagctgcatcttatctggaccagatttctagatattatattacaagagccaaattggtttctaaaatagctaaatatccccatgtggaggactatcgccgcaccgtgacagagattgatgagaaagaatatatcagccttcggctcatcatatcagagctgaggaatcaatatgtcactctacatgacatgatcctgaaaaatatcgagaagatcaaacggccccggagcagcaatgcagagactctgtactga
Sequence Length
765
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,890 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki), mRNA
NCBI Official Synonym Full Names
proteasome activator subunit 3
NCBI Official Symbol
PSME3
NCBI Official Synonym Symbols
Ki; PA28G; HEL-S-283; PA28gamma; REG-GAMMA; PA28-gamma
NCBI Protein Information
proteasome activator complex subunit 3
UniProt Protein Name
Proteasome activator complex subunit 3
Protein Family
UniProt Gene Name
PSME3
UniProt Synonym Gene Names
REG-gamma; PA28g; PA28gamma
UniProt Entry Name
PSME3_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

Uniprot Description

PSME3: a protein implicated in immunoproteasome assembly and required for efficient antigen processing. The PA28 activator complex enhances the generation of class I binding peptides by altering the cleavage pattern of the proteasome. Homohexamer. Significantly elevated in colorectal cancer patients compared with healthy donors and patients with benign bowel disease. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Proteasome complex; Nuclear receptor co-regulator; Protease

Chromosomal Location of Human Ortholog: 17q21

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus; proteasome complex

Molecular Function: identical protein binding; p53 binding; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSME3

Similar Products

Product Notes

The PSME3 psme3 (Catalog #AAA1273576) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcgt tgctgaaggt ggatcaggaa gtgaagctca aggttgattc tttcagggag cggatcacaa gtgaggcaga agacttggtg gcaaattttt tcccaaagaa gttattagaa cttgatagtt ttctgaagga accaatctta aacatccatg acctaactca gatccactct gacatgaatc tcccagtccc tgaccccatt cttctcacca atagccatga tggactggat ggtcccactt ataagaagcg aaggttggat gagtgtgaag aagccttcca aggaaccaag gtgtttgtga tgcccaatgg gatgctgaaa agcaaccagc agctggtgga cattattgag aaagtgaaac ctgagatccg gctgttgatt gagaaatgta acacggtcaa aatgtgggta cagctcctga ttcccaggat agaagatgga aacaactttg gggtgtccat tcaggaggaa acagttgcag agctaagaac tgttgagagt gaagctgcat cttatctgga ccagatttct agatattata ttacaagagc caaattggtt tctaaaatag ctaaatatcc ccatgtggag gactatcgcc gcaccgtgac agagattgat gagaaagaat atatcagcct tcggctcatc atatcagagc tgaggaatca atatgtcact ctacatgaca tgatcctgaa aaatatcgag aagatcaaac ggccccggag cagcaatgca gagactctgt actga. It is sometimes possible for the material contained within the vial of "PSME3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.