Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD9 cdna clone

PSMD9 cDNA Clone

Gene Names
PSMD9; p27; Rpn4
Synonyms
PSMD9; PSMD9 cDNA Clone; PSMD9 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgacgaggaagcgaggcagagcggaggctcctcgcaggccggcgtcgtgactgtcagcgacgtccaggagctgatgcggcgcaaggaggagatagaagcgcagatcaaggccaactatgacgtgctggaaagccaaaaaggcattgggatgaacgagccgctggtggactgtgagggctacccccggtcagacgtggacctgtaccaagtccgcaccgccaggcacaacatcatatgcctgcagaatgatcacaaggcagtgatgaagcaggtggaggaggccctgcaccagctgcacgctcgcgacaaggagaagcaggcccgggacatggctgaggcccacaaagaggccatgagccgcaaactgggtcagagtgagagccagggccctccacgggccttcgccaaagtgaacagcatcagccccggctccccagccagcatcgcgggtctgcaagtggatgatgagattgtggagttcggctctgtgaacacccagaacttccagtcactgcataacattggcagtgtggtgcagcacagtgaggggaagcccctgaatgtgacagtgatccgcaggggggaaaaacaccagcttagacttgttccaacacgctgggcaggaaaaggactgctgggctgcaacattattcctctgcaaagatga
Sequence Length
672
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,053 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 9, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 9
NCBI Official Symbol
PSMD9
NCBI Official Synonym Symbols
p27; Rpn4
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 9
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 9
UniProt Gene Name
PSMD9
UniProt Entry Name
PSMD9_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]

Uniprot Description

PSMD9: Acts as a chaperone during the assembly of the 26S proteasome, specifically of the base subcomplex of the PA700/19S regulatory complex (RC). During the base subcomplex assembly is part of an intermediate PSMD9:PSMC6:PSMC3 module, also known as modulator trimer complex; PSMD9 is released during the further base assembly process. Belongs to the proteasome subunit p27 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 12q24.31-q24.32

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: bHLH transcription factor binding; protein binding; transcription coactivator activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of insulin secretion; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of insulin secretion; positive regulation of transcription, DNA-dependent; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD9

Similar Products

Product Notes

The PSMD9 psmd9 (Catalog #AAA1269827) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgacg aggaagcgag gcagagcgga ggctcctcgc aggccggcgt cgtgactgtc agcgacgtcc aggagctgat gcggcgcaag gaggagatag aagcgcagat caaggccaac tatgacgtgc tggaaagcca aaaaggcatt gggatgaacg agccgctggt ggactgtgag ggctaccccc ggtcagacgt ggacctgtac caagtccgca ccgccaggca caacatcata tgcctgcaga atgatcacaa ggcagtgatg aagcaggtgg aggaggccct gcaccagctg cacgctcgcg acaaggagaa gcaggcccgg gacatggctg aggcccacaa agaggccatg agccgcaaac tgggtcagag tgagagccag ggccctccac gggccttcgc caaagtgaac agcatcagcc ccggctcccc agccagcatc gcgggtctgc aagtggatga tgagattgtg gagttcggct ctgtgaacac ccagaacttc cagtcactgc ataacattgg cagtgtggtg cagcacagtg aggggaagcc cctgaatgtg acagtgatcc gcagggggga aaaacaccag cttagacttg ttccaacacg ctgggcagga aaaggactgc tgggctgcaa cattattcct ctgcaaagat ga. It is sometimes possible for the material contained within the vial of "PSMD9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.