Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD6 cdna clone

PSMD6 cDNA Clone

Gene Names
PSMD6; S10; Rpn7; p42A; p44S10; SGA-113M
Synonyms
PSMD6; PSMD6 cDNA Clone; PSMD6 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgctggagaacctggaggaggagggtctgcccaagaaccccgacttgcgtatcgcgcagctgcgcttcctgctcagcctgcccgagcaccgcggagacgctgccgtgcgcgacgagctgatggcggccgtccgcgataacaacatggctccttactatgaagccttgtgcaaatccctcgactggcagatagacgtggacctactcaataaaatgaagaaggcaaatgaagatgagttgaagcgtttggatgaggagctggaagatgcagagaagaatctaggagagagcgaaattcgcgatgcaatgatggcaaaggccgagtacctctgccggataggtgacaaagagggagctctgacagcctttcgcaagacatatgacaaaactgtggccctgggtcaccgattggatattgtattctatctccttaggattggcttattttatatggataatgatctcatcacacgaaacacagaaaaggccaaaagcttaatagaagaaggaggagactgggacaggagaaaccgcctaaaagtgtatcagggtctttattgtgtggctattcgtgatttcaaacaggcagctgaactcttccttgacactgtttcaacatttacatcctatgaactcatggattataaaacatttgtgacttatactgtctatgtcagtatgattgccttagaaagaccagatctcagggaaaaggtcattaaaggagcagagattcttgaagtgttgcacagtcttccagcagttcggcagtatctgttttcactctatgaatgccgttactctgttttcttccaatcattagcggttgtggaacaggaaatgaaaaaggactggctttttgcccctcattatcgatactatgtaagagaaatgagaattcatgcatacagtcagctgctggaatcatataggtcattaacccttggctatatggcagaagcgtttggtgttggtgtggaattcattgatcaggaactgtccaggtttattgctgccgggagactacactgcaaaatagataaagtgaatgaaatagtagaaaccaacagacctgatagcaagaactggcagtaccaagaaactatcaagaaaggagatctgctactaaacagagttcaaaaactttccagagtaattaatatgtaa
Sequence Length
1170
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,923 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 6, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 6
NCBI Official Symbol
PSMD6
NCBI Official Synonym Symbols
S10; Rpn7; p42A; p44S10; SGA-113M
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 6
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 6
UniProt Gene Name
PSMD6
UniProt Synonym Gene Names
KIAA0107; PFAAP4
UniProt Entry Name
PSMD6_HUMAN

NCBI Description

This gene encodes a member of the protease subunit S10 family. The encoded protein is a subunit of the 26S proteasome which colocalizes with DNA damage foci and is involved in the ATP-dependent degradation of ubiquinated proteins. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]

Uniprot Description

PSMD6: Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins. Belongs to the proteasome subunit S10 family.

Chromosomal Location of Human Ortholog: 3p14.1

Cellular Component: cytosol; nucleoplasm; proteasome complex; proteasome regulatory particle

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD6

Similar Products

Product Notes

The PSMD6 psmd6 (Catalog #AAA1267221) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgctgg agaacctgga ggaggagggt ctgcccaaga accccgactt gcgtatcgcg cagctgcgct tcctgctcag cctgcccgag caccgcggag acgctgccgt gcgcgacgag ctgatggcgg ccgtccgcga taacaacatg gctccttact atgaagcctt gtgcaaatcc ctcgactggc agatagacgt ggacctactc aataaaatga agaaggcaaa tgaagatgag ttgaagcgtt tggatgagga gctggaagat gcagagaaga atctaggaga gagcgaaatt cgcgatgcaa tgatggcaaa ggccgagtac ctctgccgga taggtgacaa agagggagct ctgacagcct ttcgcaagac atatgacaaa actgtggccc tgggtcaccg attggatatt gtattctatc tccttaggat tggcttattt tatatggata atgatctcat cacacgaaac acagaaaagg ccaaaagctt aatagaagaa ggaggagact gggacaggag aaaccgccta aaagtgtatc agggtcttta ttgtgtggct attcgtgatt tcaaacaggc agctgaactc ttccttgaca ctgtttcaac atttacatcc tatgaactca tggattataa aacatttgtg acttatactg tctatgtcag tatgattgcc ttagaaagac cagatctcag ggaaaaggtc attaaaggag cagagattct tgaagtgttg cacagtcttc cagcagttcg gcagtatctg ttttcactct atgaatgccg ttactctgtt ttcttccaat cattagcggt tgtggaacag gaaatgaaaa aggactggct ttttgcccct cattatcgat actatgtaag agaaatgaga attcatgcat acagtcagct gctggaatca tataggtcat taacccttgg ctatatggca gaagcgtttg gtgttggtgt ggaattcatt gatcaggaac tgtccaggtt tattgctgcc gggagactac actgcaaaat agataaagtg aatgaaatag tagaaaccaa cagacctgat agcaagaact ggcagtacca agaaactatc aagaaaggag atctgctact aaacagagtt caaaaacttt ccagagtaat taatatgtaa. It is sometimes possible for the material contained within the vial of "PSMD6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.