Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD5 cdna clone

PSMD5 cDNA Clone

Gene Names
PSMD5; S5B
Synonyms
PSMD5; PSMD5 cDNA Clone; PSMD5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcccaggctttggcgctgctgagagaggtagcgaggctggaagcgccgctggaggagctacgcgcgcttcactccgtgctgcaggcagtgccgctcaacgagcttcgccagcaagcggcggagctgcgcctcggcccgctcttctccctgcttaacgagaaccatagggaaaagactactttgtgtgtatccattctggagagattgctccaagctatggaaccggttcacgtggcccggaacctcagggttgacctgcagaggggactaattcaccctgatgattctgtaaaaatcctcactctttcccagattggaagaattgttgaaaattctgatgctgttactgagattctaaataatgctgaattactaaaacaaattgtttattgcattggtggagagaatctatctgtagcaaaagcggctatcaaatccctgtcaagaatatcactaacccaagctggactggaggctttatttgaaagcaatctgctggatgatttgaaaagtgtaatgaaaacaaatgacattgttcgatacagggtgtatgagctaattatagagatttcttccgtgtcaccagaatctttaaactactgtaccacaagtggattggtaacccagctcctgagagagctgactggtgaggatgtgttggtcagagccacctgtatagaaatggtgacatcactggcatatactcatcatgggcgacaatatcttgctcaagaaggagtaattgaccaaatttctaatataattgttggggcagattcagaccctttctctagcttctatctgccaggattcgtgaagttttttggaaacctggctgtcatggatagtcctcaacagatctgtgagcgttatcctatctttgtggaaaaagtctttgaaatgatagaaagtcaggaccccactatgattggtgtagctgtagacacagttggaatcttgggatccaatgttgaaggaaaacaggttttacagaaaacaggaactcgctttgaacgcttgcttatgagaataggacatcaatcaaagaatgccccagtggagctaaaaattagatgtttggatgcaatttcatctcttctgtacttaccacctgagcagcagactgatgaccttctgaggatgacagaatcctggttttcttctttatctcgggatccactggagctcttccgtggcattagtagtcagcccttccctgaactacactgtgctgccttaaaagtgtttacggccattgcaaaccaaccctgggctcagaaacttatgtttaacagtccaggttttgtagaatatgtggtggaccggtctgtggagcatgacaaagcttcaaaggatgccaaatatgaactagtgaaagcacttgccaattccaagacaattgcagaaatctttgggaacccaaattatttgaggctcagaacttacctgagtgaagggccatactatgtgaaacctgtttccacgacagcagtagaaggagccgaatga
Sequence Length
1515
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,312 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 5, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 5
NCBI Official Symbol
PSMD5
NCBI Official Synonym Symbols
S5B
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 5
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 5
UniProt Gene Name
PSMD5
UniProt Synonym Gene Names
KIAA0072
UniProt Entry Name
PSMD5_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly. [provided by RefSeq, Jul 2012]

Uniprot Description

PSMD5: Acts as a chaperone during the assembly of the 26S proteasome, specifically of the base subcomplex of the PA700/19S regulatory complex (RC). In the initial step of the base subcomplex assembly is part of an intermediate PSMD5:PSMC2:PSMC1:PSMD2 module which probably assembles with a PSMD10:PSMC4:PSMC5:PAAF1 module followed by dissociation of PSMD5. Belongs to the proteasome subunit S5B/HSM3 family.

Protein type: Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 9q33.2

Cellular Component: cytosol; nucleoplasm; proteasome complex

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD5

Similar Products

Product Notes

The PSMD5 psmd5 (Catalog #AAA1268426) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccc aggctttggc gctgctgaga gaggtagcga ggctggaagc gccgctggag gagctacgcg cgcttcactc cgtgctgcag gcagtgccgc tcaacgagct tcgccagcaa gcggcggagc tgcgcctcgg cccgctcttc tccctgctta acgagaacca tagggaaaag actactttgt gtgtatccat tctggagaga ttgctccaag ctatggaacc ggttcacgtg gcccggaacc tcagggttga cctgcagagg ggactaattc accctgatga ttctgtaaaa atcctcactc tttcccagat tggaagaatt gttgaaaatt ctgatgctgt tactgagatt ctaaataatg ctgaattact aaaacaaatt gtttattgca ttggtggaga gaatctatct gtagcaaaag cggctatcaa atccctgtca agaatatcac taacccaagc tggactggag gctttatttg aaagcaatct gctggatgat ttgaaaagtg taatgaaaac aaatgacatt gttcgataca gggtgtatga gctaattata gagatttctt ccgtgtcacc agaatcttta aactactgta ccacaagtgg attggtaacc cagctcctga gagagctgac tggtgaggat gtgttggtca gagccacctg tatagaaatg gtgacatcac tggcatatac tcatcatggg cgacaatatc ttgctcaaga aggagtaatt gaccaaattt ctaatataat tgttggggca gattcagacc ctttctctag cttctatctg ccaggattcg tgaagttttt tggaaacctg gctgtcatgg atagtcctca acagatctgt gagcgttatc ctatctttgt ggaaaaagtc tttgaaatga tagaaagtca ggaccccact atgattggtg tagctgtaga cacagttgga atcttgggat ccaatgttga aggaaaacag gttttacaga aaacaggaac tcgctttgaa cgcttgctta tgagaatagg acatcaatca aagaatgccc cagtggagct aaaaattaga tgtttggatg caatttcatc tcttctgtac ttaccacctg agcagcagac tgatgacctt ctgaggatga cagaatcctg gttttcttct ttatctcggg atccactgga gctcttccgt ggcattagta gtcagccctt ccctgaacta cactgtgctg ccttaaaagt gtttacggcc attgcaaacc aaccctgggc tcagaaactt atgtttaaca gtccaggttt tgtagaatat gtggtggacc ggtctgtgga gcatgacaaa gcttcaaagg atgccaaata tgaactagtg aaagcacttg ccaattccaa gacaattgca gaaatctttg ggaacccaaa ttatttgagg ctcagaactt acctgagtga agggccatac tatgtgaaac ctgtttccac gacagcagta gaaggagccg aatga. It is sometimes possible for the material contained within the vial of "PSMD5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.