Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD2 cdna clone

PSMD2 cDNA Clone

Gene Names
PSMD2; S2; P97; RPN1; TRAP2
Synonyms
PSMD2; PSMD2 cDNA Clone; PSMD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagggaggccgggacaaggcgccggtgcagccccagcagtctccagcggcggcccccggcggcacggacgagaagccgagcggcaaggagcggcgggatgccggggacaaggacaaagaacaggagctgtctgaagaggataaacagcttcaagatgaactggagatgctcgtggaacgactaggggagaaggatacatccctgtatcgaccagcgctggaggaattgcgaaggcagattcgttcttctacaacttccatgacttcagtgcccaagcctctcaaatttctgcgtccacactatggcaaactgaaggaaatctatgagaacatggcccctggggagaataagcgttttgctgctgacatcatctccgttttggccatgaccatgagtggggagcgtgagtgcctcaagtatcggctagtgggctcccaggaggaattggcatcatggggtcatgagtatgtcaggcatctggcaggagaagtggctaaggagtggcaggagctggatgacgcagagaaggtccagcgggagcctctgctcactctggtgaaggaaatcgtcccctataacatggcccacaatgcagagcatgaggcttgcgacctgcttatggaaattgagcaggtggacatgctggagaaggacattgatgaaaatgcatatgcaaaggtctgcctttatctcaccagttgtgtgaattacgtgcctgagcctgagaactcagccctactgcgttgtgccctgggtgtgttccgaaagtttagccgcttccctgaagctctgagattggcattgatgctcaatgacatggagttggtagaagacatcttcacctcctgcaaggatgtggtagtacagaaacagatggcattcatgctaggccggcatggggtgttcctggagctgagtgaagatgtcgaggagtatgaggacctgacagagatcatgtccaatgtacagctcaacagcaacttcttggccttagctcgggagctggacatcatggagcccaaggtgcctgatgacatctacaaaacccacctagagaacaacaggtttgggggcagtggctctcaggtggactctgcccgcatgaacctggcctcctcttttgtgaatggctttgtgaatgcagcttttggccaagacaagctgctaacagatgatggcaacaaatggctttacaagaacaaggaccacggaatgttgagtgcagctgcatctcttgggatgattctgctgtgggatgtggatggtggcctcacccagattgacaagtacctgtactcctctgaggactacattaagtcaggagctcttcttgcctgtggcatagtgaactctggggtccggaatgagtgtgaccctgctctggcactgctctcagactatgttctccacaacagcaacaccatgagacttggttccatctttgggctaggcttggcttatgctggctcaaatcgtgaagatgtcctaacactgctgctgcctgtgatgggagattcaaagtccagcatggaggtggcaggtgtcacagctttagcctgtggaatgatagcagtagggtcctgcaatggagatgtaacttccactatccttcagaccatcatggagaagtcagagactgagctcaaggatacttatgctcgttggcttcctcttggactgggtctcaaccacctggggaagggtgaggccatcgaggcaatcctggctgcactggaggttgtgtcagagccattccgcagttttgccaacacactggtggatgtgtgtgcatatgcaggctctgggaatgtgctgaaggtgcagcagctgctccacatttgtagcgaacactttgactccaaagagaaggaggaagacaaagacaagaaggaaaagaaagacaaggacaagaaggaagcccctgctgacatgggagcacatcagggagtggctgttctggggattgcccttattgctatgggggaggagattggtgcagagatggcattacgaacctttggccacttgctgagatatggggagcctacactccggagggctgtacctttagcactggccctcatctctgtttcaaatccacgactcaacatcctggataccctaagcaaattctctcatgatgctgatccagaagtttcctattactccatttttgccatgggcatggtgggcagtggtaccaataatgcccgtctggctgcaatgctgcgccagttagctcaatatcatgccaaggacccaaacaacctcttcatggtgcgcttggcacagggcctgacacatttagggaagggcacccttaccctctgcccctaccacagcgaccggcagcttatgagccaggtggccgtggctggactgctcactgtgcttgtctctttcctggatgttcgaaacattattctaggcaaatcacactatgtattgtatgggctggtggctgccatgcagccccgaatgctggttacgtttgatgaggagctgcggccattgccagtgtctgtccgtgtgggccaggcagtggatgtggtgggccaggctggcaagccgaagactatcacagggttccagacgcatacaaccccagtgttgttggcccacggggaacgggcagaattggccactgaggagtttcttcctgttacccccattctggaaggttttgttatccttcggaagaaccccaattatgatctctaa
Sequence Length
2727
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
85,606 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 2, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 2
NCBI Official Symbol
PSMD2
NCBI Official Synonym Symbols
S2; P97; RPN1; TRAP2
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 2
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 2
UniProt Gene Name
PSMD2
UniProt Synonym Gene Names
TRAP2
UniProt Entry Name
PSMD2_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

PSMD2: Acts as a regulatory subunit of the 26 proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins. Belongs to the proteasome subunit S2 family.

Protein type: Proteasome complex; Cell cycle regulation

Chromosomal Location of Human Ortholog: 3q27.1

Cellular Component: cytosol; membrane; nucleoplasm; nucleus; proteasome complex; proteasome regulatory particle

Molecular Function: endopeptidase activity; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD2

Similar Products

Product Notes

The PSMD2 psmd2 (Catalog #AAA1276897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg gaggccggga caaggcgccg gtgcagcccc agcagtctcc agcggcggcc cccggcggca cggacgagaa gccgagcggc aaggagcggc gggatgccgg ggacaaggac aaagaacagg agctgtctga agaggataaa cagcttcaag atgaactgga gatgctcgtg gaacgactag gggagaagga tacatccctg tatcgaccag cgctggagga attgcgaagg cagattcgtt cttctacaac ttccatgact tcagtgccca agcctctcaa atttctgcgt ccacactatg gcaaactgaa ggaaatctat gagaacatgg cccctgggga gaataagcgt tttgctgctg acatcatctc cgttttggcc atgaccatga gtggggagcg tgagtgcctc aagtatcggc tagtgggctc ccaggaggaa ttggcatcat ggggtcatga gtatgtcagg catctggcag gagaagtggc taaggagtgg caggagctgg atgacgcaga gaaggtccag cgggagcctc tgctcactct ggtgaaggaa atcgtcccct ataacatggc ccacaatgca gagcatgagg cttgcgacct gcttatggaa attgagcagg tggacatgct ggagaaggac attgatgaaa atgcatatgc aaaggtctgc ctttatctca ccagttgtgt gaattacgtg cctgagcctg agaactcagc cctactgcgt tgtgccctgg gtgtgttccg aaagtttagc cgcttccctg aagctctgag attggcattg atgctcaatg acatggagtt ggtagaagac atcttcacct cctgcaagga tgtggtagta cagaaacaga tggcattcat gctaggccgg catggggtgt tcctggagct gagtgaagat gtcgaggagt atgaggacct gacagagatc atgtccaatg tacagctcaa cagcaacttc ttggccttag ctcgggagct ggacatcatg gagcccaagg tgcctgatga catctacaaa acccacctag agaacaacag gtttgggggc agtggctctc aggtggactc tgcccgcatg aacctggcct cctcttttgt gaatggcttt gtgaatgcag cttttggcca agacaagctg ctaacagatg atggcaacaa atggctttac aagaacaagg accacggaat gttgagtgca gctgcatctc ttgggatgat tctgctgtgg gatgtggatg gtggcctcac ccagattgac aagtacctgt actcctctga ggactacatt aagtcaggag ctcttcttgc ctgtggcata gtgaactctg gggtccggaa tgagtgtgac cctgctctgg cactgctctc agactatgtt ctccacaaca gcaacaccat gagacttggt tccatctttg ggctaggctt ggcttatgct ggctcaaatc gtgaagatgt cctaacactg ctgctgcctg tgatgggaga ttcaaagtcc agcatggagg tggcaggtgt cacagcttta gcctgtggaa tgatagcagt agggtcctgc aatggagatg taacttccac tatccttcag accatcatgg agaagtcaga gactgagctc aaggatactt atgctcgttg gcttcctctt ggactgggtc tcaaccacct ggggaagggt gaggccatcg aggcaatcct ggctgcactg gaggttgtgt cagagccatt ccgcagtttt gccaacacac tggtggatgt gtgtgcatat gcaggctctg ggaatgtgct gaaggtgcag cagctgctcc acatttgtag cgaacacttt gactccaaag agaaggagga agacaaagac aagaaggaaa agaaagacaa ggacaagaag gaagcccctg ctgacatggg agcacatcag ggagtggctg ttctggggat tgcccttatt gctatggggg aggagattgg tgcagagatg gcattacgaa cctttggcca cttgctgaga tatggggagc ctacactccg gagggctgta cctttagcac tggccctcat ctctgtttca aatccacgac tcaacatcct ggatacccta agcaaattct ctcatgatgc tgatccagaa gtttcctatt actccatttt tgccatgggc atggtgggca gtggtaccaa taatgcccgt ctggctgcaa tgctgcgcca gttagctcaa tatcatgcca aggacccaaa caacctcttc atggtgcgct tggcacaggg cctgacacat ttagggaagg gcacccttac cctctgcccc taccacagcg accggcagct tatgagccag gtggccgtgg ctggactgct cactgtgctt gtctctttcc tggatgttcg aaacattatt ctaggcaaat cacactatgt attgtatggg ctggtggctg ccatgcagcc ccgaatgctg gttacgtttg atgaggagct gcggccattg ccagtgtctg tccgtgtggg ccaggcagtg gatgtggtgg gccaggctgg caagccgaag actatcacag ggttccagac gcatacaacc ccagtgttgt tggcccacgg ggaacgggca gaattggcca ctgaggagtt tcttcctgtt acccccattc tggaaggttt tgttatcctt cggaagaacc ccaattatga tctctaa. It is sometimes possible for the material contained within the vial of "PSMD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.