Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD14 cdna clone

PSMD14 cDNA Clone

Gene Names
PSMD14; PAD1; POH1; RPN11
Synonyms
PSMD14; PSMD14 cDNA Clone; PSMD14 cdna clone
Ordering
For Research Use Only!
Sequence
atgttgctaaatttgcataagaagagttggatggaaggtttgacacttcaggactacagtgaacattgtaaacacaatgaatcagtggtaaaagagatgttggaattagccaagaattacaataaggctgtagaagaagaagataagatgacacctgaacagctggcaataaagaatgttggcaagcaggaccccaaacgtcatttggaggaacatgtggatgtacttatgacctcaaatattgtccagtgtttagcagctatgttggatactgtcgtatttaaataa
Sequence Length
288
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,577 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 14, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 14
NCBI Official Symbol
PSMD14
NCBI Official Synonym Symbols
PAD1; POH1; RPN11
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 14
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 14
UniProt Gene Name
PSMD14
UniProt Synonym Gene Names
POH1
UniProt Entry Name
PSDE_HUMAN

NCBI Description

This gene encodes a component of the 26S proteasome. The 26S proteasome is a large multiprotein complex that catalyzes the degradation of ubiquitinated intracellular proteins. The encoded protein is a component of the 19S regulatory cap complex of the 26S proteasome and mediates substrate deubiquitination. A pseudogene of this gene is also located on the long arm of chromosome 2. [provided by RefSeq, Feb 2012]

Uniprot Description

PSMD14: a component of the 26S proteasome. The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway.

Protein type: EC 3.4.19.-; Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 2q24.2

Cellular Component: cytosol; nucleoplasm; nucleus; proteasome complex

Molecular Function: metallopeptidase activity; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; double-strand break repair via homologous recombination; double-strand break repair via nonhomologous end joining; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; ubiquitin-dependent protein catabolic process; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD14

Similar Products

Product Notes

The PSMD14 psmd14 (Catalog #AAA1272335) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttgctaa atttgcataa gaagagttgg atggaaggtt tgacacttca ggactacagt gaacattgta aacacaatga atcagtggta aaagagatgt tggaattagc caagaattac aataaggctg tagaagaaga agataagatg acacctgaac agctggcaat aaagaatgtt ggcaagcagg accccaaacg tcatttggag gaacatgtgg atgtacttat gacctcaaat attgtccagt gtttagcagc tatgttggat actgtcgtat ttaaataa. It is sometimes possible for the material contained within the vial of "PSMD14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.