Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD10 cdna clone

PSMD10 cDNA Clone

Gene Names
PSMD10; p28; p28(GANK); dJ889N15.2
Synonyms
PSMD10; PSMD10 cDNA Clone; PSMD10 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggggtgtgtgtctaacctaatggtctgcaacctggcctacagcgggaagctggaagagttgaaggagagtattctggccgataaatccctggctactagaactgaccaggacagcagaactgcattgcactgggcatgctcagctggacatacagaaattgttgaatttttgttgcaacttggagtgccagtgaatgataaagacgatgcaggttggtctcctcttcatattgcggcttctgctggccgggatgagattgtaaaagcccttctgggaaaaggtgctcaagtgaatgctgtcaatcaaaatggctgtactcccttacattatgcagcttcgaaaaacaggcatgagatcgctgtcatgttactggaaggcggggctaatccagatgctaaggaccattatgaggctacagcaatgcaccgggcagcagccaagggtaacttgaagatgattcatatccttctgtactacaaagcatccacaaacatccaagacactgagggtaacactcctctacacttagcctgtgatgaggagagagtggaagaagcaaaactgctggtgtcccaaggagcaagtatttacattgagaataaagaagaaaagacacccctgcaagtggccaaaggtggcctgggtttaatactcaagagaatggtggaaggttaa
Sequence Length
681
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,137 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 10, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, non-ATPase 10
NCBI Official Symbol
PSMD10
NCBI Official Synonym Symbols
p28; p28(GANK); dJ889N15.2
NCBI Protein Information
26S proteasome non-ATPase regulatory subunit 10
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 10
UniProt Gene Name
PSMD10
UniProt Entry Name
PSD10_HUMAN

NCBI Description

This gene encodes a subunit of the PA700/19S complex, which is the regulatory component of the 26S proteasome. The 26S proteosome complex is required for ubiquitin-dependent protein degradation. This protein is a non-ATPase subunit that may be involved in protein-protein interactions. Aberrant expression of this gene may paly a role in tumorigenesis. Two transcripts encoding different isoforms have been described. Pseudogenes have been identified on chromosomes 3 and 20.[provided by RefSeq, Mar 2011]

Uniprot Description

PSMD10: Acts as a chaperone during the assembly of the 26S proteasome, specifically of the PA700/19S regulatory complex (RC). In the initial step of the base subcomplex assembly is part of an intermediate PSMD10:PSMC4:PSMC5:PAAF1 module which probably assembles with a PSMD5:PSMC2:PSMC1:PSMD2 module. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Proteasome complex

Chromosomal Location of Human Ortholog: Xq22.3

Cellular Component: cytoplasm; cytosol; intermediate filament cytoskeleton; nucleoplasm; nucleus; proteasome complex; proteasome regulatory particle

Molecular Function: protein binding; transcription factor binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; cytoplasmic sequestering of NF-kappaB; inhibition of NF-kappaB transcription factor; MAPKKK cascade; negative regulation of apoptosis; negative regulation of DNA damage response, signal transduction by p53 class mediator; negative regulation of MAPKKK cascade; negative regulation of transcription from RNA polymerase II promoter; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of cell growth; positive regulation of cyclin-dependent protein kinase activity; positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of protein ubiquitination; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMD10

Similar Products

Product Notes

The PSMD10 psmd10 (Catalog #AAA1269225) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggggt gtgtgtctaa cctaatggtc tgcaacctgg cctacagcgg gaagctggaa gagttgaagg agagtattct ggccgataaa tccctggcta ctagaactga ccaggacagc agaactgcat tgcactgggc atgctcagct ggacatacag aaattgttga atttttgttg caacttggag tgccagtgaa tgataaagac gatgcaggtt ggtctcctct tcatattgcg gcttctgctg gccgggatga gattgtaaaa gcccttctgg gaaaaggtgc tcaagtgaat gctgtcaatc aaaatggctg tactccctta cattatgcag cttcgaaaaa caggcatgag atcgctgtca tgttactgga aggcggggct aatccagatg ctaaggacca ttatgaggct acagcaatgc accgggcagc agccaagggt aacttgaaga tgattcatat ccttctgtac tacaaagcat ccacaaacat ccaagacact gagggtaaca ctcctctaca cttagcctgt gatgaggaga gagtggaaga agcaaaactg ctggtgtccc aaggagcaag tatttacatt gagaataaag aagaaaagac acccctgcaa gtggccaaag gtggcctggg tttaatactc aagagaatgg tggaaggtta a. It is sometimes possible for the material contained within the vial of "PSMD10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.