Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMC1 cdna clone

PSMC1 cDNA Clone

Gene Names
PSMC1; S4; p56; P26S4
Synonyms
PSMC1; PSMC1 cDNA Clone; PSMC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgccggttaaaattactgaagttagagagaattaaagactatcttctcatggaggaagaattcattagaaatcaggaacaaatgaaaccattagaagaaaagcaagaggaggaaagatcaaaagtggatgatctgagggggaccccgatgtcagtaggaaccttggaagagattattgatgacaatcgtgccatcgtgtctacatctgtgggctcagaacactacgtcagcattctttcatttgtagacaaggatctgctggaacctggctgctcggtcctgctcaaccacaaggtgcatgccgtgataggggtgctgatggatgacacggatcccctggtcacagtgatgaaggtagaaaaggccccccaggagacctatgcagatattggggggttggacaaccaaattcaggaaattaaggaatctgtggagcttcctctcacccatcctgaatattatgaagagatgggtataaagcctcctaagggggtcattctctatggtccacctggcacaggtaaaaccttgttagccaaagcagtagcaaaccaaacctcagccactttcttgagagtggttggctctgaacttattcagaagtacctaggtgatgggcccaaactcgtacgggaattgttccgagttgctgaagaacatgcaccgtccatcgtgtttattgatgaaattgacgccattgggacaaaaagatatgactccaattctggtggtgagagagaaattcagcgaacaatgttggaactgctgaaccagttggatggatttgattctaggggagatgtgaaagttatcatggccacaaaccgaatagaaactttggatccagcacttatcagaccaggccgcattgacaggaagattgagttccccctgcctgatgaaaagacgaagaagcgcatctttcagattcacacaagcaggatgacgctggctgatgatgtaaccctggacgacctgatcatggctaaagatgacctctctggtgctgacatcaaggcaatctgtacagaagctggtctgatggccttaagagaacgtagaatgaaagtaacaaatgaagacttcaaaaaatctaaagaaaatgttctttataagaaacaggaaggcacccctgaggggctgtatctctaa
Sequence Length
1323
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,167 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 1, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, ATPase 1
NCBI Official Symbol
PSMC1
NCBI Official Synonym Symbols
S4; p56; P26S4
NCBI Protein Information
26S protease regulatory subunit 4
UniProt Protein Name
26S protease regulatory subunit 4
UniProt Gene Name
PSMC1
UniProt Synonym Gene Names
P26s4
UniProt Entry Name
PRS4_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]

Uniprot Description

RPT2: The 26S protease is involved in the ATP-dependent degradation of ubiquitinated proteins. The regulatory (or ATPase) complex confers ATP dependency and substrate specificity to the 26S complex. Belongs to the AAA ATPase family.

Protein type: Proteasome complex; Protease

Chromosomal Location of Human Ortholog: 14q32.11

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus; proteasome complex

Molecular Function: ATPase activity; protein binding; TATA-binding protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; ER-associated protein catabolic process; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of transcriptional preinitiation complex assembly; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMC1

Similar Products

Product Notes

The PSMC1 psmc1 (Catalog #AAA1268178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcaaa gtcagagtgg tggtcatggt cctggaggtg gcaagaagga tgacaaggac aagaaaaaga aatatgaacc tcctgtacca actagagtgg ggaaaaagaa gaagaaaaca aagggaccag atgctgccag caaactgcca ctggtgacac ctcacactca gtgccggtta aaattactga agttagagag aattaaagac tatcttctca tggaggaaga attcattaga aatcaggaac aaatgaaacc attagaagaa aagcaagagg aggaaagatc aaaagtggat gatctgaggg ggaccccgat gtcagtagga accttggaag agattattga tgacaatcgt gccatcgtgt ctacatctgt gggctcagaa cactacgtca gcattctttc atttgtagac aaggatctgc tggaacctgg ctgctcggtc ctgctcaacc acaaggtgca tgccgtgata ggggtgctga tggatgacac ggatcccctg gtcacagtga tgaaggtaga aaaggccccc caggagacct atgcagatat tggggggttg gacaaccaaa ttcaggaaat taaggaatct gtggagcttc ctctcaccca tcctgaatat tatgaagaga tgggtataaa gcctcctaag ggggtcattc tctatggtcc acctggcaca ggtaaaacct tgttagccaa agcagtagca aaccaaacct cagccacttt cttgagagtg gttggctctg aacttattca gaagtaccta ggtgatgggc ccaaactcgt acgggaattg ttccgagttg ctgaagaaca tgcaccgtcc atcgtgttta ttgatgaaat tgacgccatt gggacaaaaa gatatgactc caattctggt ggtgagagag aaattcagcg aacaatgttg gaactgctga accagttgga tggatttgat tctaggggag atgtgaaagt tatcatggcc acaaaccgaa tagaaacttt ggatccagca cttatcagac caggccgcat tgacaggaag attgagttcc ccctgcctga tgaaaagacg aagaagcgca tctttcagat tcacacaagc aggatgacgc tggctgatga tgtaaccctg gacgacctga tcatggctaa agatgacctc tctggtgctg acatcaaggc aatctgtaca gaagctggtc tgatggcctt aagagaacgt agaatgaaag taacaaatga agacttcaaa aaatctaaag aaaatgttct ttataagaaa caggaaggca cccctgaggg gctgtatctc taa. It is sometimes possible for the material contained within the vial of "PSMC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.