Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMB5 cdna clone

PSMB5 cDNA Clone

Gene Names
PSMB5; X; MB1; LMPX
Synonyms
PSMB5; PSMB5 cDNA Clone; PSMB5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcttgccagcgtgttggagagaccgctaccggtgaaccagcgcgggtttttcggacttgggggtcgtgcagatctgctggatctaggtccagggagtctcagtgatggtctgagcctggccgcgccaggctggggtgtcccagaagagccaggaatcgaaatgcttcatggaacaaccaccctggccttcaagttccgccatggagtcatagttgcagctgactccagggctacagcgggtgcttacattgcctcccagacggtgaagaaggtgatagagatcaacccatacctgcttggcaccatggctgggggcgcagcggattgcagcttctgggaacggctgttggctcggcaatgtcgaatctatgagcttcgaaataaggaacgcatctctgtagcagctgcctccaaactgcttgccaacatggtgtatcagtacaaaggcatggggctgtccatgggcaccatgatctgtggctgggataagagaggccctggcctctactacgtggacagtgaagggaaccggatttcaggggccaccttctctgtaggttctggctctgtgtatgcatatggggtcatggatcggggctattcctatgacctggaagtggagcaggcctatgatctggcccgtcgagccatctaccaagccacctacagagatgcctactcaggaggtgcagtcaacctctaccacgtgcgggaggatggctggatccgagtctccagtgacaatgtggctgatctacatgagaagtatagtggctctaccccctga
Sequence Length
792
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,782 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) subunit, beta type, 5, mRNA
NCBI Official Synonym Full Names
proteasome subunit beta 5
NCBI Official Symbol
PSMB5
NCBI Official Synonym Symbols
X; MB1; LMPX
NCBI Protein Information
proteasome subunit beta type-5
UniProt Protein Name
Proteasome subunit beta type-5
Protein Family
UniProt Gene Name
PSMB5
UniProt Synonym Gene Names
LMPX; MB1; X
UniProt Entry Name
PSB5_HUMAN

NCBI Description

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]

Uniprot Description

PSMB5: The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. This unit is responsible of the chymotrypsin-like activity of the proteasome and is one of the principal target of the proteasome inhibitor bortezomib. May catalyze basal processing of intracellular antigens. Plays a role in the protection against oxidative damage through the Nrf2-ARE pathway. Belongs to the peptidase T1B family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Proteasome complex; EC 3.4.25.1; Protease

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: centrosome; cytosol; nucleoplasm; nucleus; proteasome complex; proteasome core complex

Molecular Function: peptidase activity; protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; proteolysis; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMB5

Similar Products

Product Notes

The PSMB5 psmb5 (Catalog #AAA1273864) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcttg ccagcgtgtt ggagagaccg ctaccggtga accagcgcgg gtttttcgga cttgggggtc gtgcagatct gctggatcta ggtccaggga gtctcagtga tggtctgagc ctggccgcgc caggctgggg tgtcccagaa gagccaggaa tcgaaatgct tcatggaaca accaccctgg ccttcaagtt ccgccatgga gtcatagttg cagctgactc cagggctaca gcgggtgctt acattgcctc ccagacggtg aagaaggtga tagagatcaa cccatacctg cttggcacca tggctggggg cgcagcggat tgcagcttct gggaacggct gttggctcgg caatgtcgaa tctatgagct tcgaaataag gaacgcatct ctgtagcagc tgcctccaaa ctgcttgcca acatggtgta tcagtacaaa ggcatggggc tgtccatggg caccatgatc tgtggctggg ataagagagg ccctggcctc tactacgtgg acagtgaagg gaaccggatt tcaggggcca ccttctctgt aggttctggc tctgtgtatg catatggggt catggatcgg ggctattcct atgacctgga agtggagcag gcctatgatc tggcccgtcg agccatctac caagccacct acagagatgc ctactcagga ggtgcagtca acctctacca cgtgcgggag gatggctgga tccgagtctc cagtgacaat gtggctgatc tacatgagaa gtatagtggc tctaccccct ga. It is sometimes possible for the material contained within the vial of "PSMB5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.