Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMB4 cdna clone

PSMB4 cDNA Clone

Gene Names
PSMB4; HN3; HsN3; PROS26; PROS-26
Synonyms
PSMB4; PSMB4 cDNA Clone; PSMB4 cdna clone
Ordering
For Research Use Only!
Sequence
atggaagcgtttttggggtcgcggtccggactttgggcggggggtccggccccaggacagttttaccgcattccatccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgttaagttcgagggcggagtggtgattgccgcagacatgctgggatcctacggctccttggctcgtttccgcaacatctctcgcattatgcgagtcaacaacagtaccatgctgggtgcctctggcgactacgctgatttccagtatttgaagcaagttctcggccagatggtgattgatgaggagcttctgggagatggacacagctatagtcctagagctattcattcatggctgaccagggccatgtacagccggcgctcgaagatgaaccctttgtggaacaccatggtcatcggaggctatgctgatggagagagcttcctcggttatgtggacatgcttggtgtagcctatgaagccccttcgctggccactggttatggtgcatacttggctcagcctctgctgcgagaagttctggagaagcagccagtgctaagccagaccgaggcccgcgacttagtagaacgctgcatgcgagtgctgtactaccgagatgcccgttcttacaaccggtttcaaatcgccactgtcaccgaaaaaggtgttgaaatagagggaccattgtctacagagaccaactgggatattgcccacatgatcagtggctttgaatga
Sequence Length
795
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,204 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) subunit, beta type, 4, mRNA
NCBI Official Synonym Full Names
proteasome subunit beta 4
NCBI Official Symbol
PSMB4
NCBI Official Synonym Symbols
HN3; HsN3; PROS26; PROS-26
NCBI Protein Information
proteasome subunit beta type-4
UniProt Protein Name
Proteasome subunit beta type-4
Protein Family
UniProt Gene Name
PSMB4
UniProt Synonym Gene Names
PROS26; HsBPROS26; PROS-26; HsN3
UniProt Entry Name
PSB4_HUMAN

NCBI Description

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. [provided by RefSeq, Jul 2008]

Uniprot Description

PSMB4: a proteasomal protein of the T1B peptidase family. The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway.

Protein type: Protease; Proteasome complex; EC 3.4.25.1; Cytoskeletal; Cell cycle regulation

Chromosomal Location of Human Ortholog: 1q21

Cellular Component: cytosol; nucleoplasm; nucleus; proteasome complex; proteasome core complex

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMB4

Similar Products

Product Notes

The PSMB4 psmb4 (Catalog #AAA1269432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcgt ttttggggtc gcggtccgga ctttgggcgg ggggtccggc cccaggacag ttttaccgca ttccatccac tcccgattcc ttcatggatc cggcgtctgc actttacaga ggtccaatca cgcggaccca gaaccccatg gtgaccggga cctcagtcct cggcgttaag ttcgagggcg gagtggtgat tgccgcagac atgctgggat cctacggctc cttggctcgt ttccgcaaca tctctcgcat tatgcgagtc aacaacagta ccatgctggg tgcctctggc gactacgctg atttccagta tttgaagcaa gttctcggcc agatggtgat tgatgaggag cttctgggag atggacacag ctatagtcct agagctattc attcatggct gaccagggcc atgtacagcc ggcgctcgaa gatgaaccct ttgtggaaca ccatggtcat cggaggctat gctgatggag agagcttcct cggttatgtg gacatgcttg gtgtagccta tgaagcccct tcgctggcca ctggttatgg tgcatacttg gctcagcctc tgctgcgaga agttctggag aagcagccag tgctaagcca gaccgaggcc cgcgacttag tagaacgctg catgcgagtg ctgtactacc gagatgcccg ttcttacaac cggtttcaaa tcgccactgt caccgaaaaa ggtgttgaaa tagagggacc attgtctaca gagaccaact gggatattgc ccacatgatc agtggctttg aatga. It is sometimes possible for the material contained within the vial of "PSMB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.