Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMA3 cdna clone

PSMA3 cDNA Clone

Gene Names
PSMA3; HC8; PSC3
Synonyms
PSMA3; PSMA3 cDNA Clone; PSMA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctcaatcggcactgggtatgacctgtcagcctctacattctctcctgacggaagagtttttcaagttgaatatgctatgaaggctgtggaaaatagtagtacagctattggaatcagatgcaaagatggtgttgtctttggggtagaaaaattagtcctttctaaactttatgaagaaggttccaacaaaagactttttaatgttgatcggcatgttggaatggcagtagcaggtttgttggcagatgctcgttctttagcggacatggcaagagaagaagcttccaacttcagatctaactttggctacaacattccactaaaacatcttgcagacagagtggccatgtatgtgcatgcatatacactctacagtgctgttagaccttttggctgcagtttcatgttagggtcttacagtgtgaatgacggtgcgcaactctacatgattgacccatcaggtgtttcatacggttattggggctgtgccatcggcaaagccagacaagctgcaaagacggaaatagagaagcttcagatgaaagaaatgacctgccgtgatatcgttaaagaagttgcaaaaataatttacatagtacatgacgaagttaaggataaagcttttgaactagaactcagctgggttggtgaattaactaatggaagacatgaaattgttccaaaagatataagagaagaagcagagaaatatgctaaggaatctctgaaggaagaagatgaatcagatgatgataatatgtaa
Sequence Length
768
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,647 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 3, mRNA
NCBI Official Synonym Full Names
proteasome subunit alpha 3
NCBI Official Symbol
PSMA3
NCBI Official Synonym Symbols
HC8; PSC3
NCBI Protein Information
proteasome subunit alpha type-3
UniProt Protein Name
Proteasome subunit alpha type-3
UniProt Gene Name
PSMA3
UniProt Synonym Gene Names
HC8; PSC8
UniProt Entry Name
PSA3_HUMAN

NCBI Description

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

PSMA3: a proteasomal protein of the T1A peptidase family. The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. Two alternatively spliced isoforms have been identified.

Protein type: Protease; Proteasome complex; EC 3.4.25.1

Chromosomal Location of Human Ortholog: 14q23

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus; proteasome complex; proteasome core complex

Molecular Function: protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of endopeptidase activity; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMA3

Similar Products

Product Notes

The PSMA3 psma3 (Catalog #AAA1274903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcaa tcggcactgg gtatgacctg tcagcctcta cattctctcc tgacggaaga gtttttcaag ttgaatatgc tatgaaggct gtggaaaata gtagtacagc tattggaatc agatgcaaag atggtgttgt ctttggggta gaaaaattag tcctttctaa actttatgaa gaaggttcca acaaaagact ttttaatgtt gatcggcatg ttggaatggc agtagcaggt ttgttggcag atgctcgttc tttagcggac atggcaagag aagaagcttc caacttcaga tctaactttg gctacaacat tccactaaaa catcttgcag acagagtggc catgtatgtg catgcatata cactctacag tgctgttaga ccttttggct gcagtttcat gttagggtct tacagtgtga atgacggtgc gcaactctac atgattgacc catcaggtgt ttcatacggt tattggggct gtgccatcgg caaagccaga caagctgcaa agacggaaat agagaagctt cagatgaaag aaatgacctg ccgtgatatc gttaaagaag ttgcaaaaat aatttacata gtacatgacg aagttaagga taaagctttt gaactagaac tcagctgggt tggtgaatta actaatggaa gacatgaaat tgttccaaaa gatataagag aagaagcaga gaaatatgct aaggaatctc tgaaggaaga agatgaatca gatgatgata atatgtaa. It is sometimes possible for the material contained within the vial of "PSMA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.