Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSG3 cdna clone

PSG3 cDNA Clone

Synonyms
PSG3; PSG3 cDNA Clone; PSG3 cdna clone
Ordering
For Research Use Only!
Sequence
atggggcccctctcagcccctccctgcacacagcgcatcacctggaaggggctcctgctcacagcattacttttaaacttctggaacttgcctaccactgcccaagtcacgattgaagccgagccaaccaaagtttccaaggggaaggacgttcttctacttgtccacaatttgccccagaatcttgctggctacatctggtacaaagggcaaatgaaggacctctaccattacattacatcatacgtagtagatggtcaaataattatatatgggcctgcatacagtggacgagaaacagtatattccaatgcatccctgctgatccagaatgtcacccgggaggacgcaggatcctacaccttacacatcgtaaagcgaggtgatgggactagaggagaaactggacatttcaccttcaccttatacctggagactcccaagccctccatctccagcagcaacttataccccagggaggacatggaggctgtgagcttaacctgtgatcctgagactccggacgcaagctacctgtggtggatgaatggtcagagcctccctatgactcacagcttgcagttgtccaaaaacaaaaggaccctctttctatttggtgtcacaaagtacactgcaggaccctatgaatgtgaaatacggaacccagtgagtgccagccgcagtgacccagtcaccctgaatctcctcccgaagctgcccaagccctacatcaccatcaacaacttaaaccccagggagaataaggatgtcttagccttcacctgtgaacctaagagtgagaactacacctacatttggtggctaaatggtcagagcctcccggtcagtcccagggtaaagcgacccattgaaaacaggatcctcattctacccagtgtcacgagaaatgaaacaggaccctatcaatgtgaaatacaggaccgatatggtggcatccgcagttacccagtcaccctgaatgtcctctatggtccagacctccccagaatttacccttcattcacctattaccattcaggagaaaacctctacttgtcctgcttcgcggactctaacccaccagcagaatattcttggacaattaatgggaagtttcagctatcaggacaaaagctctttatcccccagattactacaaagcatagcgggctctatgcttgctctgttcgtaactcagccactggcatggaaagctccaaatccatgacagtcgaagtctctgctccttcaggaacaggacatcttcctggccttaatccattatag
Sequence Length
1287
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,945 Da
NCBI Official Full Name
Homo sapiens pregnancy specific beta-1-glycoprotein 3, mRNA
NCBI Official Synonym Full Names
pregnancy specific beta-1-glycoprotein 3
NCBI Official Symbol
PSG3
NCBI Protein Information
pregnancy-specific beta-1-glycoprotein 3
UniProt Protein Name
Pregnancy-specific beta-1-glycoprotein 3
UniProt Gene Name
PSG3
UniProt Synonym Gene Names
PS-beta-G-3; PSBG-3; Pregnancy-specific glycoprotein 3
UniProt Entry Name
PSG3_HUMAN

NCBI Description

The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]). For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]

Uniprot Description

PSG3: Belongs to the immunoglobulin superfamily. CEA family

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 19q13.2

Biological Process: defense response; female pregnancy

Similar Products

Product Notes

The PSG3 psg3 (Catalog #AAA1268463) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggcccc tctcagcccc tccctgcaca cagcgcatca cctggaaggg gctcctgctc acagcattac ttttaaactt ctggaacttg cctaccactg cccaagtcac gattgaagcc gagccaacca aagtttccaa ggggaaggac gttcttctac ttgtccacaa tttgccccag aatcttgctg gctacatctg gtacaaaggg caaatgaagg acctctacca ttacattaca tcatacgtag tagatggtca aataattata tatgggcctg catacagtgg acgagaaaca gtatattcca atgcatccct gctgatccag aatgtcaccc gggaggacgc aggatcctac accttacaca tcgtaaagcg aggtgatggg actagaggag aaactggaca tttcaccttc accttatacc tggagactcc caagccctcc atctccagca gcaacttata ccccagggag gacatggagg ctgtgagctt aacctgtgat cctgagactc cggacgcaag ctacctgtgg tggatgaatg gtcagagcct ccctatgact cacagcttgc agttgtccaa aaacaaaagg accctctttc tatttggtgt cacaaagtac actgcaggac cctatgaatg tgaaatacgg aacccagtga gtgccagccg cagtgaccca gtcaccctga atctcctccc gaagctgccc aagccctaca tcaccatcaa caacttaaac cccagggaga ataaggatgt cttagccttc acctgtgaac ctaagagtga gaactacacc tacatttggt ggctaaatgg tcagagcctc ccggtcagtc ccagggtaaa gcgacccatt gaaaacagga tcctcattct acccagtgtc acgagaaatg aaacaggacc ctatcaatgt gaaatacagg accgatatgg tggcatccgc agttacccag tcaccctgaa tgtcctctat ggtccagacc tccccagaat ttacccttca ttcacctatt accattcagg agaaaacctc tacttgtcct gcttcgcgga ctctaaccca ccagcagaat attcttggac aattaatggg aagtttcagc tatcaggaca aaagctcttt atcccccaga ttactacaaa gcatagcggg ctctatgctt gctctgttcg taactcagcc actggcatgg aaagctccaa atccatgaca gtcgaagtct ctgctccttc aggaacagga catcttcctg gccttaatcc attatag. It is sometimes possible for the material contained within the vial of "PSG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.