Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRUNE2 cdna clone

PRUNE2 cDNA Clone

Gene Names
PRUNE2; BMCC1; BNIPXL; C9orf65; KIAA0367
Synonyms
PRUNE2; PRUNE2 cDNA Clone; PRUNE2 cdna clone
Ordering
For Research Use Only!
Sequence
atggacatcccctttgaagagggcgtgctgagtcccagtgctgcagacatgaggcctgaacctcctaattctctggatcttaatgacactcatcctcggagaatcaagctcacagccccaaatatcaatctttctctggaccaaagtgaaggatctattctctctgatgataacttggacagtcctgatgaaattgacatcaatgtggatgaacttgatacccccgatgaagcagattcttttgagtacactggccatgaagatcccacagccaacaaagattctggccaagagtcagagtctattccagaatatacggccgaagaggaacgggaggacaaccggctttggaggacagtggtcattggagaacaagagcagcgcattgacatgaaggtcatcgagccctacaggagagtcatttctcacggaggatactatggggacggtctaaatgccatcattgtgtttgccgcctgttttctgccagacagcagtcgggcggattaccactatgtcatggaaaatcttttcctatatgtaataagtactttcacactacagccgcagagctga
Sequence Length
576
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,093 Da
NCBI Official Full Name
Homo sapiens prune homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
prune homolog 2
NCBI Official Symbol
PRUNE2
NCBI Official Synonym Symbols
BMCC1; BNIPXL; C9orf65; KIAA0367
NCBI Protein Information
protein prune homolog 2
UniProt Protein Name
Protein prune homolog 2
Protein Family
UniProt Gene Name
PRUNE2
UniProt Synonym Gene Names
BMCC1; BNIPXL; C9orf65; KIAA0367
UniProt Entry Name
PRUN2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Uniprot Description

PRUNE2: May play an important role in regulating differentiation, survival and aggressiveness of the tumor cells. Belongs to the PPase class C family. Prune subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 9q21.2

Biological Process: apoptosis

Research Articles on PRUNE2

Similar Products

Product Notes

The PRUNE2 prune2 (Catalog #AAA1274324) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacatcc cctttgaaga gggcgtgctg agtcccagtg ctgcagacat gaggcctgaa cctcctaatt ctctggatct taatgacact catcctcgga gaatcaagct cacagcccca aatatcaatc tttctctgga ccaaagtgaa ggatctattc tctctgatga taacttggac agtcctgatg aaattgacat caatgtggat gaacttgata cccccgatga agcagattct tttgagtaca ctggccatga agatcccaca gccaacaaag attctggcca agagtcagag tctattccag aatatacggc cgaagaggaa cgggaggaca accggctttg gaggacagtg gtcattggag aacaagagca gcgcattgac atgaaggtca tcgagcccta caggagagtc atttctcacg gaggatacta tggggacggt ctaaatgcca tcattgtgtt tgccgcctgt tttctgccag acagcagtcg ggcggattac cactatgtca tggaaaatct tttcctatat gtaataagta ctttcacact acagccgcag agctga. It is sometimes possible for the material contained within the vial of "PRUNE2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.