Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRPF3 cdna clone

PRPF3 cDNA Clone

Gene Names
PRPF3; PRP3; RP18; HPRP3; Prp3p; HPRP3P; SNRNP90
Synonyms
PRPF3; PRPF3 cDNA Clone; PRPF3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcactgtcaaagagggagctggatgagctgaaaccatggatagagaagacagtgaagagggtcctgggtttctcagagcctacggtggtcacagcagcattgaactgtgtggggaagggcatggacaagaagaaggcagccgatcatctgaaaccttttcttgatgattctactctccgatttgtggacaaactgtttgaggctgtggaggaaggccgaagctctaggcattccaagtctagcagtgacaggagcagaaaacgagagctaaaggaggtgtttggtgatgactctgagatctctaaagaatcatcaggagtaaagaagcgacgaataccccgttttgaggaggtggaagaagagccagaggtgatccctgggcctccatcagagagccctggcatgctgactaagctccagatcaaacagatgatggaggcagcaacacgacaaatcgaggagaggaaaaaacagctgagcttcattagcccccctacacctcagccaaagactccttcttcctcccaaccagaacgacttcctattggcaacactattcagccctcccaggctgccactttcatgaatgatgccattgagaaggcaaggaaagcagctgaactgcaagctcgaatccaagcccagctggcactgaagccaggactcatcggcaatgccaacatggtgggcctggctaatctccatgccatgggcattgctcccccgaaggtggagttaaaagaccaaacgaaacctacaccactgatcctggatgagcaagggcgcactgtagatgcaacaggcaaggagattgagctgacacaccgcatgcctactctgaaagccaatattcgtgctgtgaagagggaacaattcaagcaacaactaaaggaaaagccatcagaagacatggaatccaataccttttttgacccccgagtctccattgccccttcccagcgccagagacgcacttttaaattccatgacaagggcaaatttgagaagattgctcagcgattacggacaaaggctcaactggagaagctacaggcagagatttcacaagcagctcgaaaaacaggcatccatacttcgactaggcttgccctcattgctcctaagaaggagctaaaggaaggagatattcctgaaattgagtggtgggactcttacataatccccaatggctttgatcttacagaggaaaatcccaagagagaagattattttggaatcacaaatcttgttgaacatccagcccagctcaatcctccagttgacaatgacacaccagttactctgggagtatatcttaccaagaaggaacagaaaaaacttcggagacaaacaaggagggaagcacagaaggaactacaagaaaaagtcaggctgggcctgatgcctcctccagaacccaaagtgagaatttctaatttgatgcgagtattaggaacagaagctgttcaagaccccacgaaggtagaagcccacgtcagagctcagatggcaaaaagacagaaagcgcatgaagaggccaacgctgcccgaaaactcacagcagaacagagaaaggtcaagaaaattaaaaagcttaaagaagacatttcacagggggtacacatatctgtatatagagttcgaaatttgagcaacccagccaagaagttcaagattgaagccaatgctgggcaactgtacctgacaggggtggtggtactgcacaaggatgtcaacgtggtagtagtggaagggggccccaaggcccagaagaaatttaagcgtcttatgctgcatcggataaagtgggatgaacagacatctaacacaaagggagatgatgatgaggagtctgatgaggaagctgtgaagaaaaccaacaaatgtgtactagtctgggagggtacagccaaagaccggagctttggagagatgaagtttaaacagtgtcctacagagaacatggctcgtgagcatttcaaaaagcatggggctgaacactactgggaccttgcgctgagtgaatctgtgttagagtccactgattga
Sequence Length
2052
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,889 Da
NCBI Official Full Name
Homo sapiens PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
pre-mRNA processing factor 3
NCBI Official Symbol
PRPF3
NCBI Official Synonym Symbols
PRP3; RP18; HPRP3; Prp3p; HPRP3P; SNRNP90
NCBI Protein Information
U4/U6 small nuclear ribonucleoprotein Prp3
UniProt Protein Name
U4/U6 small nuclear ribonucleoprotein Prp3
UniProt Gene Name
PRPF3
UniProt Synonym Gene Names
HPRP3; PRP3; hPrp3
UniProt Entry Name
PRPF3_HUMAN

NCBI Description

The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]

Uniprot Description

PRPF3: Participates in pre-mRNA splicing. May play a role in the assembly of the U4/U5/U6 tri-snRNP complex. Defects in PRPF3 are the cause of retinitis pigmentosa type 18 (RP18). RP leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. RP18 inheritance is autosomal dominant.

Protein type: Spliceosome; RNA splicing; RNA processing

Chromosomal Location of Human Ortholog: 1q21.1

Cellular Component: Cajal body; cytoplasm; nucleoplasm; nucleus; U4/U6 x U5 tri-snRNP complex

Molecular Function: identical protein binding; protein binding

Biological Process: assembly of spliceosomal tri-snRNP; mRNA processing; nuclear mRNA splicing, via spliceosome; RNA splicing; RNA splicing, via transesterification reactions

Disease: Retinitis Pigmentosa 18

Research Articles on PRPF3

Similar Products

Product Notes

The PRPF3 prpf3 (Catalog #AAA1276436) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcactgt caaagaggga gctggatgag ctgaaaccat ggatagagaa gacagtgaag agggtcctgg gtttctcaga gcctacggtg gtcacagcag cattgaactg tgtggggaag ggcatggaca agaagaaggc agccgatcat ctgaaacctt ttcttgatga ttctactctc cgatttgtgg acaaactgtt tgaggctgtg gaggaaggcc gaagctctag gcattccaag tctagcagtg acaggagcag aaaacgagag ctaaaggagg tgtttggtga tgactctgag atctctaaag aatcatcagg agtaaagaag cgacgaatac cccgttttga ggaggtggaa gaagagccag aggtgatccc tgggcctcca tcagagagcc ctggcatgct gactaagctc cagatcaaac agatgatgga ggcagcaaca cgacaaatcg aggagaggaa aaaacagctg agcttcatta gcccccctac acctcagcca aagactcctt cttcctccca accagaacga cttcctattg gcaacactat tcagccctcc caggctgcca ctttcatgaa tgatgccatt gagaaggcaa ggaaagcagc tgaactgcaa gctcgaatcc aagcccagct ggcactgaag ccaggactca tcggcaatgc caacatggtg ggcctggcta atctccatgc catgggcatt gctcccccga aggtggagtt aaaagaccaa acgaaaccta caccactgat cctggatgag caagggcgca ctgtagatgc aacaggcaag gagattgagc tgacacaccg catgcctact ctgaaagcca atattcgtgc tgtgaagagg gaacaattca agcaacaact aaaggaaaag ccatcagaag acatggaatc caataccttt tttgaccccc gagtctccat tgccccttcc cagcgccaga gacgcacttt taaattccat gacaagggca aatttgagaa gattgctcag cgattacgga caaaggctca actggagaag ctacaggcag agatttcaca agcagctcga aaaacaggca tccatacttc gactaggctt gccctcattg ctcctaagaa ggagctaaag gaaggagata ttcctgaaat tgagtggtgg gactcttaca taatccccaa tggctttgat cttacagagg aaaatcccaa gagagaagat tattttggaa tcacaaatct tgttgaacat ccagcccagc tcaatcctcc agttgacaat gacacaccag ttactctggg agtatatctt accaagaagg aacagaaaaa acttcggaga caaacaagga gggaagcaca gaaggaacta caagaaaaag tcaggctggg cctgatgcct cctccagaac ccaaagtgag aatttctaat ttgatgcgag tattaggaac agaagctgtt caagacccca cgaaggtaga agcccacgtc agagctcaga tggcaaaaag acagaaagcg catgaagagg ccaacgctgc ccgaaaactc acagcagaac agagaaaggt caagaaaatt aaaaagctta aagaagacat ttcacagggg gtacacatat ctgtatatag agttcgaaat ttgagcaacc cagccaagaa gttcaagatt gaagccaatg ctgggcaact gtacctgaca ggggtggtgg tactgcacaa ggatgtcaac gtggtagtag tggaaggggg ccccaaggcc cagaagaaat ttaagcgtct tatgctgcat cggataaagt gggatgaaca gacatctaac acaaagggag atgatgatga ggagtctgat gaggaagctg tgaagaaaac caacaaatgt gtactagtct gggagggtac agccaaagac cggagctttg gagagatgaa gtttaaacag tgtcctacag agaacatggc tcgtgagcat ttcaaaaagc atggggctga acactactgg gaccttgcgc tgagtgaatc tgtgttagag tccactgatt ga. It is sometimes possible for the material contained within the vial of "PRPF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.