PROCA1 cdna clone
PROCA1 cDNA Clone
Synonyms
PROCA1; PROCA1 cDNA Clone; PROCA1 cdna clone
Sequence
atgtgggtcaggacgacgctcacaattgaaagatggactaaggaaaagaccgagcccaaggcccgctcgtgggatgagagcagatgccgcggtgactgcaaggagcctgacaagtgctgctggagacacaagcagtgcactgggcacatcatctaccctttcgcctctgactgtgtccgccacagcctgcacctacactctgtcaaccactgcaactgtaattctaggctgaaggactcttcagaggatagcagcagctcccggggcgcgggcccaacctgctcccatgtcatcgagtccccttgctttgagctcacaccggaggaggagcatgtggagcgattccggtatggctggtgcaaaagctacagacctgtctctgtggcagtgatccaccatccactctaccatgagtgtggggcagatgatctaaatgaagaagaggaagaggaggaggaggaaagcaagccccccatcccgacacaggtggggcccgccaccgcctcccctgacctaggcaccagcatggccactggtacccctgactccacagcgcccatcaccatctggcgctctgagagccccacagggaagggtcagggcagcaaggtgatcaagaaggtaaagaagaaaaaggaaaaagagaaagacaaggaggagatggatgagaaggcaaagctgaagaaaaaagccaagaaaggccagttgactaagaagaaaagcccggttaaattggagccttccccgccagacgtgagccgatcattaagcgcaagacagctggccaggatgtccgagtccagcccagaaagccgggaagagctggagagcgaggacagttacaatggccgggggcagggagaactgtccagcgaggatattgtggaatcatcatcgcccaggaagagagagaacacagtccaggccaaaaagacaggggcaaagccctcacaagccaggaaggtaaacaagagaaaatctcccccaggatcaaaccccaacctcagttga
Sequence Length
1011
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,398 Da
NCBI Official Full Name
Homo sapiens proline-rich cyclin A1-interacting protein, mRNA
NCBI Official Synonym Full Names
protein interacting with cyclin A1
NCBI Official Symbol
PROCA1
NCBI Protein Information
protein PROCA1
UniProt Protein Name
Protein PROCA1
Protein Family
UniProt Gene Name
PROCA1
UniProt Entry Name
PRCA1_HUMAN
Uniprot Description
PROCA1: Belongs to the PROCA1 family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Cell cycle regulation
Chromosomal Location of Human Ortholog: 17q11.2
Similar Products
Product Notes
The PROCA1 proca1 (Catalog #AAA1271873) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggtca ggacgacgct cacaattgaa agatggacta aggaaaagac cgagcccaag gcccgctcgt gggatgagag cagatgccgc ggtgactgca aggagcctga caagtgctgc tggagacaca agcagtgcac tgggcacatc atctaccctt tcgcctctga ctgtgtccgc cacagcctgc acctacactc tgtcaaccac tgcaactgta attctaggct gaaggactct tcagaggata gcagcagctc ccggggcgcg ggcccaacct gctcccatgt catcgagtcc ccttgctttg agctcacacc ggaggaggag catgtggagc gattccggta tggctggtgc aaaagctaca gacctgtctc tgtggcagtg atccaccatc cactctacca tgagtgtggg gcagatgatc taaatgaaga agaggaagag gaggaggagg aaagcaagcc ccccatcccg acacaggtgg ggcccgccac cgcctcccct gacctaggca ccagcatggc cactggtacc cctgactcca cagcgcccat caccatctgg cgctctgaga gccccacagg gaagggtcag ggcagcaagg tgatcaagaa ggtaaagaag aaaaaggaaa aagagaaaga caaggaggag atggatgaga aggcaaagct gaagaaaaaa gccaagaaag gccagttgac taagaagaaa agcccggtta aattggagcc ttccccgcca gacgtgagcc gatcattaag cgcaagacag ctggccagga tgtccgagtc cagcccagaa agccgggaag agctggagag cgaggacagt tacaatggcc gggggcaggg agaactgtcc agcgaggata ttgtggaatc atcatcgccc aggaagagag agaacacagt ccaggccaaa aagacagggg caaagccctc acaagccagg aaggtaaaca agagaaaatc tcccccagga tcaaacccca acctcagttg a. It is sometimes possible for the material contained within the vial of "PROCA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
