Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRMT8 cdna clone

PRMT8 cDNA Clone

Gene Names
PRMT8; HRMT1L3; HRMT1L4
Synonyms
PRMT8; PRMT8 cDNA Clone; PRMT8 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaagctgctgaacccagaggagatgacctcgagagattattacttcgactcctatgcccactttgggatccacgaggaaatgctgaaggatgaggtgcggactctcacttaccggaactccatgtaccacaacaagcacgtgttcaaggacaaagtggtactggatgtggggagtggtactgggatcctttccatgttcgctgccaaggcaggggccaagaaggtgtttgggatcgaatgctccagtatttctgactactcacagaagatcattaaggccaaccacttggacaacatcatcaccatatttaagggtaaagtggaagaggtggagctgcctgtggagaaggtggacatcatcatcagcgagtggatgggctactgtctgttctatgagtccatgctcaacacggtgatctttgccagggacaagtggctgaaacctggagggcttatgtttccagaccgggcagctttgtacgtggtagcgattgaagacagacagtacaaggacttcaaaatccactggtgggagaatgtctatggctttgacatgacctgcatcagggacgtggccatgaaggagcctctagtggacatcgtggatccaaagcaagtggtgaccaatgcctgtttgataaaggaggtggacatttacacagtgaagacggaagagctatcgttcacatctgcattctgcctgcagatacagcgcaacgactacgtccacgccctggtcacctattttaatattgaatttaccaagtgccacaagaaaatggggttttccacagcccctgatgctccctacacccactggaagcagaccgtcttctacttggaagattacctcactgtccggaggggggaggaaatctacgggaccatatccatgaagccaaatgccaaaaatgtgcgagacctcgatttcacagtagacttggattttaagggacagctgtgtgaaacatctgtatctaatgactacaaaatgcgttag
Sequence Length
1005
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,169 Da
NCBI Official Full Name
Homo sapiens protein arginine methyltransferase 8, mRNA
NCBI Official Synonym Full Names
protein arginine methyltransferase 8
NCBI Official Symbol
PRMT8
NCBI Official Synonym Symbols
HRMT1L3; HRMT1L4
NCBI Protein Information
protein arginine N-methyltransferase 8
UniProt Protein Name
Protein arginine N-methyltransferase 8
UniProt Gene Name
PRMT8
UniProt Synonym Gene Names
HRMT1L3; HRMT1L4
UniProt Entry Name
ANM8_HUMAN

NCBI Description

Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]

Uniprot Description

PRMT8: Membrane-associated arginine methyltransferase that can both catalyze the formation of omega-N monomethylarginine (MMA) and asymmetrical dimethylarginine (aDMA). Able to mono- and dimethylate EWS protein; however its precise role toward EWS remains unclear as it still interacts with fully methylated EWS. Belongs to the protein arginine N-methyltransferase family. PRMT8 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Methyltransferase, protein arginine; EC 2.1.1.-

Chromosomal Location of Human Ortholog: 12p13.3

Cellular Component: cytosol; nucleus; plasma membrane

Molecular Function: histone-arginine N-methyltransferase activity; identical protein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; protein-arginine omega-N asymmetric methyltransferase activity; protein-arginine omega-N monomethyltransferase activity; S-adenosylmethionine-dependent methyltransferase activity

Biological Process: histone methylation; peptidyl-arginine methylation; peptidyl-arginine methylation, to asymmetrical-dimethyl arginine; regulation of protein binding; regulation of transcription, DNA-dependent

Research Articles on PRMT8

Similar Products

Product Notes

The PRMT8 prmt8 (Catalog #AAA1270709) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccaagc tgctgaaccc agaggagatg acctcgagag attattactt cgactcctat gcccactttg ggatccacga ggaaatgctg aaggatgagg tgcggactct cacttaccgg aactccatgt accacaacaa gcacgtgttc aaggacaaag tggtactgga tgtggggagt ggtactggga tcctttccat gttcgctgcc aaggcagggg ccaagaaggt gtttgggatc gaatgctcca gtatttctga ctactcacag aagatcatta aggccaacca cttggacaac atcatcacca tatttaaggg taaagtggaa gaggtggagc tgcctgtgga gaaggtggac atcatcatca gcgagtggat gggctactgt ctgttctatg agtccatgct caacacggtg atctttgcca gggacaagtg gctgaaacct ggagggctta tgtttccaga ccgggcagct ttgtacgtgg tagcgattga agacagacag tacaaggact tcaaaatcca ctggtgggag aatgtctatg gctttgacat gacctgcatc agggacgtgg ccatgaagga gcctctagtg gacatcgtgg atccaaagca agtggtgacc aatgcctgtt tgataaagga ggtggacatt tacacagtga agacggaaga gctatcgttc acatctgcat tctgcctgca gatacagcgc aacgactacg tccacgccct ggtcacctat tttaatattg aatttaccaa gtgccacaag aaaatggggt tttccacagc ccctgatgct ccctacaccc actggaagca gaccgtcttc tacttggaag attacctcac tgtccggagg ggggaggaaa tctacgggac catatccatg aagccaaatg ccaaaaatgt gcgagacctc gatttcacag tagacttgga ttttaaggga cagctgtgtg aaacatctgt atctaatgac tacaaaatgc gttag. It is sometimes possible for the material contained within the vial of "PRMT8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.