Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRM2 cdna clone

PRM2 cDNA Clone

Gene Names
PRM2; CT94.2
Synonyms
PRM2; PRM2 cDNA Clone; PRM2 cdna clone
Ordering
For Research Use Only!
Sequence
atggtccgataccgcgtgaggagcctgagcgaacgctcgcacgaggtgtacaggcagcagttgcatgggcaagagcaaggacaccacggccaagaggagcaagggctgagcccggagcacgtcgaggtctacgagaggacccatggccagtctcactataggcgcagacactgctctcgaaggaggctgcaccggatccacaggcggcagcatcgctcctgcagaaggcgcaaaagacgctcctgcaggcaccggaggaggcatcgcagaggctgcagaaccaggaagagaacatgcagaaggcactaa
Sequence Length
309
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,106 Da
NCBI Official Full Name
Homo sapiens protamine 2, mRNA
NCBI Official Synonym Full Names
protamine 2
NCBI Official Symbol
PRM2
NCBI Official Synonym Symbols
CT94.2
NCBI Protein Information
protamine-2
UniProt Protein Name
Protamine-2
UniProt Gene Name
PRM2
UniProt Synonym Gene Names
P2'
UniProt Entry Name
PRM2_HUMAN

NCBI Description

Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis, and are the major DNA-binding proteins in the nucleus of sperm in many vertebrates. They package the sperm DNA into a highly condensed complex in a volume less than 5% of a somatic cell nucleus. Many mammalian species have only one protamine (protamine 1); however, a few species, including human and mouse, have two. This gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Sep 2015]

Uniprot Description

PRM2: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. Belongs to the protamine P2 family.

Protein type: DNA-binding; Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 16p13.2

Cellular Component: nucleoplasm; nucleus

Biological Process: chromosome condensation; DNA packaging; nuclear organization and biogenesis; spermatid development; spermatogenesis

Research Articles on PRM2

Similar Products

Product Notes

The PRM2 prm2 (Catalog #AAA1269994) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtccgat accgcgtgag gagcctgagc gaacgctcgc acgaggtgta caggcagcag ttgcatgggc aagagcaagg acaccacggc caagaggagc aagggctgag cccggagcac gtcgaggtct acgagaggac ccatggccag tctcactata ggcgcagaca ctgctctcga aggaggctgc accggatcca caggcggcag catcgctcct gcagaaggcg caaaagacgc tcctgcaggc accggaggag gcatcgcaga ggctgcagaa ccaggaagag aacatgcaga aggcactaa. It is sometimes possible for the material contained within the vial of "PRM2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.