Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKAG2 cdna clone

PRKAG2 cDNA Clone

Gene Names
PRKAG2; AAKG; CMH6; WPWS; AAKG2; H91620p
Synonyms
PRKAG2; PRKAG2 cDNA Clone; PRKAG2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggagaagctggagttcgaggacgaagcagtagaagactcagaaagtggtgtttacatgcgattcatgaggtcacacaagtgttatgacatcgttccaaccagttcaaagcttgttgtctttgatactacattacaagttaaaaaggccttctttgctttggtagccaacggtgtccgagcagcgccactgtgggagagtaaaaaacaaagttttgtaggaatgctaacaattacagatttcataaatatactacatagatactataaatcacctatggtacagatttatgaattagaggaacataaaattgaaacatggagggagctttatttacaagaaacatttaagcctttagtgaatatatctccagatgcaagcctcttcgatgctgtatactccttgatcaaaaataaaatccacagattgcccgttattgaccctatcagtgggaatgcactttatatacttacccacaaaagaatcctcaagttcctccagctttttatgtctgatatgccaaagcctgccttcatgaagcagaacctggatgagcttggaataggaacgtaccacaacattgccttcatacatccagacactcccatcatcaaagccttgaacatatttgtggaaagacgaatatcagctctgcctgttgtggatgagtcaggaaaagttgtagatatttattccaaatttgatgtaattaatcttgctgctgagaaaacatacaataacctagatatcacggtgacccaggcccttcagcaccgttcacagtattttgaaggtgttgtgaagtgcaataagctggaaatactggagaccatcgtggacagaatagtaagagctgaggtccatcggctggtggtggtaaatgaagcagatagtattgtgggtattatttccctgtcggacattctgcaagccctgatcctcacaccagcaggtgccaaacaaaaggagacagaaacggagtga
Sequence Length
987
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,439 Da
NCBI Official Full Name
Homo sapiens protein kinase, AMP-activated, gamma 2 non-catalytic subunit, mRNA
NCBI Official Synonym Full Names
protein kinase AMP-activated non-catalytic subunit gamma 2
NCBI Official Symbol
PRKAG2
NCBI Official Synonym Symbols
AAKG; CMH6; WPWS; AAKG2; H91620p
NCBI Protein Information
5'-AMP-activated protein kinase subunit gamma-2
UniProt Protein Name
5'-AMP-activated protein kinase subunit gamma-2
UniProt Gene Name
PRKAG2
UniProt Synonym Gene Names
AMPK gamma2; AMPK subunit gamma-2
UniProt Entry Name
AAKG2_HUMAN

NCBI Description

AMP-activated protein kinase (AMPK) is a heterotrimeric protein composed of a catalytic alpha subunit, a noncatalytic beta subunit, and a noncatalytic regulatory gamma subunit. Various forms of each of these subunits exist, encoded by different genes. AMPK is an important energy-sensing enzyme that monitors cellular energy status and functions by inactivating key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This gene is a member of the AMPK gamma subunit family. Mutations in this gene have been associated with Wolff-Parkinson-White syndrome, familial hypertrophic cardiomyopathy, and glycogen storage disease of the heart. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2015]

Uniprot Description

AMPKG2: AMP/ATP-binding subunit of AMP-activated protein kinase (AMPK), an energy sensor protein kinase that plays a key role in regulating cellular energy metabolism. In response to reduction of intracellular ATP levels, AMPK activates energy-producing pathways and inhibits energy-consuming processes: inhibits protein, carbohydrate and lipid biosynthesis, as well as cell growth and proliferation. AMPK acts via direct phosphorylation of metabolic enzymes, and by longer-term effects via phosphorylation of transcription regulators. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton; probably by indirectly activating myosin. Gamma non-catalytic subunit mediates binding to AMP, ADP and ATP, leading to activate or inhibit AMPK: AMP-binding results in allosteric activation of alpha catalytic subunit (PRKAA1 or PRKAA2) both by inducing phosphorylation and preventing dephosphorylation of catalytic subunits. ADP also stimulates phosphorylation, without stimulating already phosphorylated catalytic subunit. ATP promotes dephosphorylation of catalytic subunit, rendering the AMPK enzyme inactive. AMPK is a heterotrimer of an alpha catalytic subunit (PRKAA1 or PRKAA2), a beta (PRKAB1 or PRKAB2) and a gamma non- catalytic subunits (PRKAG1, PRKAG2 or PRKAG3). Interacts with FNIP1 and FNIP2. Isoform B is ubiquitously expressed except in liver and thymus. The highest level is detected in heart with abundant expression in placenta and testis. Belongs to the 5'-AMP-activated protein kinase gamma subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Autophagy; Protein kinase, regulatory subunit

Chromosomal Location of Human Ortholog: 7q36.1

Cellular Component: AMP-activated protein kinase complex; cytosol; extracellular space; nucleoplasm

Molecular Function: ADP binding; ATP binding; cAMP-dependent protein kinase inhibitor activity; cAMP-dependent protein kinase regulator activity; phosphorylase kinase regulator activity; protein kinase activator activity; protein kinase binding

Biological Process: ATP biosynthetic process; carnitine shuttle; cell cycle arrest; glycogen metabolic process; macroautophagy; negative regulation of protein kinase activity; positive regulation of protein kinase activity; regulation of fatty acid biosynthetic process; regulation of fatty acid metabolic process; regulation of fatty acid oxidation; regulation of glucose import; regulation of glycolysis; sterol biosynthetic process

Disease: Cardiomyopathy, Familial Hypertrophic, 6; Glycogen Storage Disease Of Heart, Lethal Congenital; Wolff-parkinson-white Syndrome

Research Articles on PRKAG2

Similar Products

Product Notes

The PRKAG2 prkag2 (Catalog #AAA1275470) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaga agctggagtt cgaggacgaa gcagtagaag actcagaaag tggtgtttac atgcgattca tgaggtcaca caagtgttat gacatcgttc caaccagttc aaagcttgtt gtctttgata ctacattaca agttaaaaag gccttctttg ctttggtagc caacggtgtc cgagcagcgc cactgtggga gagtaaaaaa caaagttttg taggaatgct aacaattaca gatttcataa atatactaca tagatactat aaatcaccta tggtacagat ttatgaatta gaggaacata aaattgaaac atggagggag ctttatttac aagaaacatt taagccttta gtgaatatat ctccagatgc aagcctcttc gatgctgtat actccttgat caaaaataaa atccacagat tgcccgttat tgaccctatc agtgggaatg cactttatat acttacccac aaaagaatcc tcaagttcct ccagcttttt atgtctgata tgccaaagcc tgccttcatg aagcagaacc tggatgagct tggaatagga acgtaccaca acattgcctt catacatcca gacactccca tcatcaaagc cttgaacata tttgtggaaa gacgaatatc agctctgcct gttgtggatg agtcaggaaa agttgtagat atttattcca aatttgatgt aattaatctt gctgctgaga aaacatacaa taacctagat atcacggtga cccaggccct tcagcaccgt tcacagtatt ttgaaggtgt tgtgaagtgc aataagctgg aaatactgga gaccatcgtg gacagaatag taagagctga ggtccatcgg ctggtggtgg taaatgaagc agatagtatt gtgggtatta tttccctgtc ggacattctg caagccctga tcctcacacc agcaggtgcc aaacaaaagg agacagaaac ggagtga. It is sometimes possible for the material contained within the vial of "PRKAG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.