Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDX4 cdna clone

PRDX4 cDNA Clone

Gene Names
PRDX4; PRX-4; AOE372; AOE37-2; HEL-S-97n
Synonyms
PRDX4; PRDX4 cDNA Clone; PRDX4 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcgctgccgctgctagccgcgacaactccggaccacggccgccaccgaaggctgcttctgctgccgctactgctgttcctgctgccggctggagctgtgcagggctgggagacagaggagaggccccggactcgcgaagaggagtgccacttctacgcgggtggacaagtgtacccgggagaggcatcccgggtatcggtcgccgaccactccctgcacctaagcaaagcgaagatttccaagccagcgccctactgggaaggaacagctgtgatcgatggagaatttaaggagctgaagttaactgattatcgtgggaaatacttggttttcttcttctacccacttgatttcacatttgtgtgtccaactgaaattatcgcttttggcgacagacttgaagaattcagatctataaatactgaagtggtagcatgctctgttgattcacagtttacccatttggcctggattaatacccctcgaagacaaggaggacttgggccaataaggattccacttctttcagatttgacccatcagatctcaaaggactatggtgtatacctagaggactcaggccacactcttagaggtctcttcattattgatgacaaaggaatcctaagacaaattactctgaatgatcttcctgtgggtagatcagtggatgagacactacgtttggttcaagcattccagtacactgacaaacacggagaagtctgccctgctggctggaaacctggtagtgaaacaataatcccagatccagctggaaagctgaagtatttcgataaactgaattga
Sequence Length
816
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,540 Da
NCBI Official Full Name
Homo sapiens peroxiredoxin 4, mRNA
NCBI Official Synonym Full Names
peroxiredoxin 4
NCBI Official Symbol
PRDX4
NCBI Official Synonym Symbols
PRX-4; AOE372; AOE37-2; HEL-S-97n
NCBI Protein Information
peroxiredoxin-4
UniProt Protein Name
Peroxiredoxin-4
Protein Family
UniProt Gene Name
PRDX4
UniProt Synonym Gene Names
AOE37-2; Prx-IV
UniProt Entry Name
PRDX4_HUMAN

NCBI Description

The protein encoded by this gene is an antioxidant enzyme and belongs to the peroxiredoxin family. The protein is localized to the cytoplasm. Peroxidases of the peroxiredoxin family reduce hydrogen peroxide and alkyl hydroperoxides to water and alcohol with the use of reducing equivalents derived from thiol-containing donor molecules. This protein has been found to play a regulatory role in the activation of the transcription factor NF-kappaB. [provided by RefSeq, Jul 2008]

Uniprot Description

PRDX4: Probably involved in redox regulation of the cell. Regulates the activation of NF-kappa-B in the cytosol by a modulation of I-kappa-B-alpha phosphorylation. Belongs to the AhpC/TSA family.

Protein type: Mitochondrial; Secreted, signal peptide; Secreted; EC 1.11.1.15; Oxidoreductase

Chromosomal Location of Human Ortholog: Xp22.11

Cellular Component: nucleus

Molecular Function: protein binding; thioredoxin peroxidase activity

Biological Process: I-kappaB phosphorylation

Research Articles on PRDX4

Similar Products

Product Notes

The PRDX4 prdx4 (Catalog #AAA1277599) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgc tgccgctgct agccgcgaca actccggacc acggccgcca ccgaaggctg cttctgctgc cgctactgct gttcctgctg ccggctggag ctgtgcaggg ctgggagaca gaggagaggc cccggactcg cgaagaggag tgccacttct acgcgggtgg acaagtgtac ccgggagagg catcccgggt atcggtcgcc gaccactccc tgcacctaag caaagcgaag atttccaagc cagcgcccta ctgggaagga acagctgtga tcgatggaga atttaaggag ctgaagttaa ctgattatcg tgggaaatac ttggttttct tcttctaccc acttgatttc acatttgtgt gtccaactga aattatcgct tttggcgaca gacttgaaga attcagatct ataaatactg aagtggtagc atgctctgtt gattcacagt ttacccattt ggcctggatt aatacccctc gaagacaagg aggacttggg ccaataagga ttccacttct ttcagatttg acccatcaga tctcaaagga ctatggtgta tacctagagg actcaggcca cactcttaga ggtctcttca ttattgatga caaaggaatc ctaagacaaa ttactctgaa tgatcttcct gtgggtagat cagtggatga gacactacgt ttggttcaag cattccagta cactgacaaa cacggagaag tctgccctgc tggctggaaa cctggtagtg aaacaataat cccagatcca gctggaaagc tgaagtattt cgataaactg aattga. It is sometimes possible for the material contained within the vial of "PRDX4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.