Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP2R2B cdna clone

PPP2R2B cDNA Clone

Gene Names
PPP2R2B; PR52B; SCA12; B55BETA; PR55BETA; PP2ABBETA; PP2APR55B; PR2ABBETA; PR55-BETA; PP2AB55BETA; PR2AB55BETA; PP2APR55BETA; PR2APR55BETA
Synonyms
PPP2R2B; PPP2R2B cDNA Clone; PPP2R2B cdna clone
Ordering
For Research Use Only!
Sequence
atggaggaggacattgatacccgcaaaatcaacaacagtttcctgcgcgaccacagctatgcgaccgaagctgacattatctctacggtagaattcaaccacacgggagaattactagcgacaggggacaaggggggtcgggttgtaatatttcaacgagagcaggagagtaaaaatcaggttcatcgtaggggtgaatacaatgtttacagcacattccagagccatgaacccgagttcgattacctgaagagtttagaaatagaagaaaaaatcaataaaataagatggctcccccagcagaatgcagcttactttcttctgtctactaatgataaaactgtgaagctgtggaaagtcagcgagcgtgataagaggccagaaggctacaatctgaaagatgaggagggccggctccgggatcctgccaccatcacaaccctgcgggtgcctgtcctgagacccatggacctgatggtggaggccaccccacgaagagtatttgccaacgcacacacatatcacatcaactccatatctgtcaacagcgactatgaaacctacatgtccgctgatgacctgaggattaacctatggaactttgaaataaccaatcaaagttttaatattgtggacattaagccagccaacatggaggagctcacggaggtgatcacagcagccgagttccacccccatcattgcaacaccttcgtgtacagcagcagcaaagggacaatccggctgtgtgacatgcgggcatctgccctgtgtgacaggcacaccaaattttttgaagagccggaagatccaagcaacagatcatttttctctgaaattatctcttcgatttcggatgtgaagttcagccacagtgggaggtatatcatgaccagggactacttgaccgtcaaagtctgggatctcaacatggaaaaccgccccatcgagacttaccaggttcatgactacctccgcagcaagctgtgttccctctatgaaaatgactgcatttttgataaatttgagtgtgtgtggaatgggtcagacagtgtcatcatgacaggctcctacaacaacttcttcaggatgttcgacagaaacaccaagcgtgatgtgacccttgaggcttcgagggaaaacagcaagccccgggctatcctcaaaccccgaaaagtgtgtgtggggggcaagcggagaaaagacgagatcagtgtcgacagtctggactttagcaaaaagatcttgcatacagcttggcatccttcagaaaatattatagcagtggcggctacaaataacctatatatattccaggacaaggttaactag
Sequence Length
1332
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,505 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform, mRNA
NCBI Official Synonym Full Names
protein phosphatase 2 regulatory subunit Bbeta
NCBI Official Symbol
PPP2R2B
NCBI Official Synonym Symbols
PR52B; SCA12; B55BETA; PR55BETA; PP2ABBETA; PP2APR55B; PR2ABBETA; PR55-BETA; PP2AB55BETA; PR2AB55BETA; PP2APR55BETA; PR2APR55BETA
NCBI Protein Information
serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B beta isoform
UniProt Protein Name
Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B beta isoform
UniProt Gene Name
PPP2R2B
UniProt Entry Name
2ABB_HUMAN

NCBI Description

The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 55-78 copies in cases of SCA12. [provided by RefSeq, Jul 2016]

Uniprot Description

PPP2R2B: the B regulatory subunit of PP2A. May modulate substrate selectivity and catalytic activity, and directs the localization of the catalytic enzyme to particular subcellular compartments. PPP2R2B promotes autophagy and oxidative stress induced cell death that is related to apoptosis. The PP2A holoenzyme consists of a common heterodimeric core enzyme composed of a 36 kDa catalytic subunit (subunit C) and a 65 kDa constant regulatory subunit (subunit A), that associates with a variety of regulatory subunits. Three families of regulatory subunits associate with the core dimmer: B (R2/PR55/B55), B¿ (R5/B56), and B¿ (R3/PR72/PR130/PR59). Five isoforms of the human protein are produced by alternative splicing. Isoform 1 (Bbeta1) localizes within the cytoplasm. Isoform 2 (Bbeta2) localizes to both cytosolic and mitochondrial compartments under basal conditions, relocating to the mitochondrial compartment during apoptosis. Its targeting to the outer mitochondrial membrane (OMM) involves an association with import receptors of the TOM complex and is required to promote proapoptotic activity. The N-terminal 26 residues of isoform 2 constitute a cryptic mitochondrial matrix import signal that is necessary and sufficient for targeting the PP2A holoenzyme to the OMM. The last WD repeat of isoform 2 constitutes a mitochondrial stop-transfer domain that prevents PPP2R2B matrix translocation and signal sequence cleavage. Defects in PPP2R2B are the cause of spinocerebellar ataxia type 12 (SCA12).

Protein type: Apoptosis; Protein phosphatase, regulatory subunit; Motility/polarity/chemotaxis; Mitochondrial

Chromosomal Location of Human Ortholog: 5q32

Cellular Component: mitochondrial outer membrane; mitochondrion

Molecular Function: protein binding

Disease: Spinocerebellar Ataxia 12

Research Articles on PPP2R2B

Similar Products

Product Notes

The PPP2R2B ppp2r2b (Catalog #AAA1278095) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagg acattgatac ccgcaaaatc aacaacagtt tcctgcgcga ccacagctat gcgaccgaag ctgacattat ctctacggta gaattcaacc acacgggaga attactagcg acaggggaca aggggggtcg ggttgtaata tttcaacgag agcaggagag taaaaatcag gttcatcgta ggggtgaata caatgtttac agcacattcc agagccatga acccgagttc gattacctga agagtttaga aatagaagaa aaaatcaata aaataagatg gctcccccag cagaatgcag cttactttct tctgtctact aatgataaaa ctgtgaagct gtggaaagtc agcgagcgtg ataagaggcc agaaggctac aatctgaaag atgaggaggg ccggctccgg gatcctgcca ccatcacaac cctgcgggtg cctgtcctga gacccatgga cctgatggtg gaggccaccc cacgaagagt atttgccaac gcacacacat atcacatcaa ctccatatct gtcaacagcg actatgaaac ctacatgtcc gctgatgacc tgaggattaa cctatggaac tttgaaataa ccaatcaaag ttttaatatt gtggacatta agccagccaa catggaggag ctcacggagg tgatcacagc agccgagttc cacccccatc attgcaacac cttcgtgtac agcagcagca aagggacaat ccggctgtgt gacatgcggg catctgccct gtgtgacagg cacaccaaat tttttgaaga gccggaagat ccaagcaaca gatcattttt ctctgaaatt atctcttcga tttcggatgt gaagttcagc cacagtggga ggtatatcat gaccagggac tacttgaccg tcaaagtctg ggatctcaac atggaaaacc gccccatcga gacttaccag gttcatgact acctccgcag caagctgtgt tccctctatg aaaatgactg catttttgat aaatttgagt gtgtgtggaa tgggtcagac agtgtcatca tgacaggctc ctacaacaac ttcttcagga tgttcgacag aaacaccaag cgtgatgtga cccttgaggc ttcgagggaa aacagcaagc cccgggctat cctcaaaccc cgaaaagtgt gtgtgggggg caagcggaga aaagacgaga tcagtgtcga cagtctggac tttagcaaaa agatcttgca tacagcttgg catccttcag aaaatattat agcagtggcg gctacaaata acctatatat attccaggac aaggttaact ag. It is sometimes possible for the material contained within the vial of "PPP2R2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.