Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PPP1R8 cdna clone

PPP1R8 cDNA Clone

Gene Names
PPP1R8; ARD1; ARD-1; NIPP1; NIPP-1; PRO2047
Synonyms
PPP1R8; PPP1R8 cDNA Clone; PPP1R8 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtggagaggatgatgaactcaagggcttactggggcttccagaggaggaaactgagcttgataacctgacagagttcaacactgcccacaacaagcggatttctacccttaccattgaggagggaaatctggacattcaaagaccaaagaggaagaggaagaactcacgggtgacattcagtgaggatgatgagatcatcaacccagaggatgtggatccctcagttggtcgattcaggaacatggtgcaaactgcagtggtcccagtcaagaagaagcgtgtggagggccctggctccctgggcctggaggaatcagggagcaggcgcatgcagaactttgccttcagcggaggactctacgggggcctgccccccacacacagtgaagcaggctcccagccacatggcatccatgggacagcactcatcggtggcttgcccatgccatacccaaaccttgcccctgatgtggacttgactcctgttgtgccgtcagcagtgaacatgaaccctgcaccaaaccctgcagtctataaccctgaagctgtaaatgaacccaagaagaagaaatatgcaaaagaggcttggccaggcaagaagcccacaccttccttgctgatttga
Sequence Length
630
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,344 Da
NCBI Official Full Name
Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 8, mRNA
NCBI Official Synonym Full Names
protein phosphatase 1 regulatory subunit 8
NCBI Official Symbol
PPP1R8
NCBI Official Synonym Symbols
ARD1; ARD-1; NIPP1; NIPP-1; PRO2047
NCBI Protein Information
nuclear inhibitor of protein phosphatase 1
UniProt Protein Name
Nuclear inhibitor of protein phosphatase 1
UniProt Gene Name
PPP1R8
UniProt Synonym Gene Names
ARD1; NIPP1; NIPP-1
UniProt Entry Name
PP1R8_HUMAN

NCBI Description

This gene, through alternative splicing, encodes three different isoforms. Two of the protein isoforms encoded by this gene are specific inhibitors of type 1 serine/threonine protein phosphatases and can bind but not cleave RNA. The third protein isoform lacks the phosphatase inhibitory function but is a single-strand endoribonuclease comparable to RNase E of E. coli. This isoform requires magnesium for its function and cleaves specific sites in A+U-rich regions of RNA. [provided by RefSeq, Jul 2008]

Uniprot Description

NIPP-1: Inhibitor subunit of the major nuclear protein phosphatase-1 (PP-1). It has RNA-binding activity but does not cleave RNA and may target PP-1 to RNA-associated substrates. May also be involved in pre-mRNA splicing. Binds DNA and might act as a transcriptional repressor. Seems to be required for cell proliferation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Inhibitor; Motility/polarity/chemotaxis; Protein phosphatase, regulatory subunit; Ribonuclease; EC 3.1.4.-

Chromosomal Location of Human Ortholog: 1p35.3

Cellular Component: nuclear speck; nucleoplasm; nucleus

Molecular Function: protein binding; ribonuclease E activity; type 1 serine/threonine specific protein phosphatase inhibitor activity

Biological Process: RNA catabolic process

Research Articles on PPP1R8

Similar Products

Product Notes

The PPP1R8 ppp1r8 (Catalog #AAA1275165) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtggag aggatgatga actcaagggc ttactggggc ttccagagga ggaaactgag cttgataacc tgacagagtt caacactgcc cacaacaagc ggatttctac ccttaccatt gaggagggaa atctggacat tcaaagacca aagaggaaga ggaagaactc acgggtgaca ttcagtgagg atgatgagat catcaaccca gaggatgtgg atccctcagt tggtcgattc aggaacatgg tgcaaactgc agtggtccca gtcaagaaga agcgtgtgga gggccctggc tccctgggcc tggaggaatc agggagcagg cgcatgcaga actttgcctt cagcggagga ctctacgggg gcctgccccc cacacacagt gaagcaggct cccagccaca tggcatccat gggacagcac tcatcggtgg cttgcccatg ccatacccaa accttgcccc tgatgtggac ttgactcctg ttgtgccgtc agcagtgaac atgaaccctg caccaaaccc tgcagtctat aaccctgaag ctgtaaatga acccaagaag aagaaatatg caaaagaggc ttggccaggc aagaagccca caccttcctt gctgatttga. It is sometimes possible for the material contained within the vial of "PPP1R8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.